← return to the list of all guides
Name | Primer Sequence |
---|---|
guideRna310fwT7sense | TAGGctgggattaggagcttactt |
guideRna310fwT7antisense | AAACaagtaagctcctaatcccag |
Name | Primer Sequence |
---|---|
guideRNA310fwT7crTarget | GAAATTAATACGACTCACTATAGctgggattaggagcttacttGTTTTAGAGCTAGAAATAGCAAG |
guideRNAallT7common (constant primer used for all guide RNAs) | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
One protocol for template preparation from oligonucleotides and in-vitro transcription can be found in Bassett et al. Cell Rep 2013. We also provide our own optimized protocol for T7 guide expression.
Gagnon et al. PLoS ONE 2014 prefixed guides with GG to ensure high efficiency in vitro transcription by T7 RNA polymerase. It has been shown by other authors that the 5' nucleotides of the guide have little or no role in target specificity and it is therefore generally accepted that prefixing guides with GG should not affect activity.
However, in our lab, we found that in vitro transcription with T7 RNA polymerase is efficient enough when the sequence starts with a single G rather than with GG. This took some optimization of the reaction conditions including using large amounts of template DNA and running reactions overnight. Click here to download our optimized protocol for T7 guide expression.
Do not use G-prefixing with high-fidelity Cas9 Variants like HF1 and eSpCas9 1.1 when this adds a mismatch in the genome as the efficiency will most likely be very low.
Name | Primer Sequence |
---|---|
guideRNA310fwGeneArtFw | TACGACTCACTATAGctgggattaggagcttactt |
guideRNA310fwGeneArtRev | TTCTAGCTCTAAAACaagtaagctcctaatcccag |
To clone the guide into MLM3636 (Joung lab), use these primers:
Note: Efficient transcription from the U6 promoter requires a 5' G. This is not the case for this guide. Several options are possible, you can either add an additional G- prefix to the N20 guide sequence, called gN20 guides here, or replace the first with a G and create a gN19 guide. For users of HF1 and eSpCas9: G- prefixing with the high-fidelity variants may reduce efficiency, as it introduces a mismatch.
Primers for gN20 guides:Name | Primer Sequence |
---|---|
gN20-guideRNA310fwU6senseMLM3636 | ACACCGctgggattaggagcttacttG |
gN20-guideRNA310fwU6antisenseMLM3636 | AAAACaagtaagctcctaatcccagCG |
Primers for gN19 guides:
Kim et al 2020. showed that changing the first nucleotide to 'G' is slightly more efficient.
Name | Primer Sequence |
---|---|
gN19-gN20-guideRNA310fwU6senseMLM3636 | ACACCGtgggattaggagcttacttG |
gN19-gN20-guideRNA310fwU6antisenseMLM3636 | AAAACaagtaagctcctaatcccaCG |
The plasmid has to be digested with: BsmBI
Click here to download the cloning protocol for MLM3636 (Joung lab)
Name | Oligonucleotide Sequence |
---|---|
batchOligo310fw | GGAAAGGACGAAACACCGctgggattaggagcttacttGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC |
guideRNA310fwGeneArtFw | TACGACTCACTATAGctgggattaggagcttactt |
guideRNA310fwGeneArtRev | TTCTAGCTCTAAAACaagtaagctcctaatcccag |
gN20-guideRNA310fwU6senseMLM3636 | ACACCGctgggattaggagcttacttG |
gN20-guideRNA310fwU6antisenseMLM3636 | AAAACaagtaagctcctaatcccagCG |
guideRna310fwT7sense | TAGGctgggattaggagcttactt |
guideRna310fwT7antisense | AAACaagtaagctcctaatcccag |
guideRNA310fwT7crTarget | GAAATTAATACGACTCACTATAGctgggattaggagcttacttGTTTTAGAGCTAGAAATAGCAAG |
guideRNAallT7common | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
gN19-gN20-guideRNA310fwU6senseMLM3636 | ACACCGtgggattaggagcttacttG |
gN19-gN20-guideRNA310fwU6antisenseMLM3636 | AAAACaagtaagctcctaatcccaCG |
OntargetGuideRna310fwLeft | TTGCAGCAGGAGGATGACAG | Tm 60.036 |
OntargetGuideRna310fwRight | CACCATCTTCTCTGGCGGTT | Tm 60.036 |
Method: Primer3.2 with default settings, target length 250-400 bp,
Primers for all off-targets can be downloaded from the Off-target PCR page.
Oligonucleotides of all guides for pooled cloning into a lentiviral vector can be downloaded from the Saturating mutagenesis page.