← return to the list of all guides

Contents:

PCR primers for off-targets of GTTCCCGGTGGCGCAGTCTG GGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Maximum amplicon length:     Primer Tm:

NamePrimer Sequence Tm CFD Score
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314226_F TCGTCGGCAGCGTCAGAAATCGAGGTGAGCTGCA 59.3 1.00
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314226_R GTCTCGTGGGCTCGGGAAGGGAACTGTGGGTGGAG 59.9 1.00
mm4_intergenic_Gm12442|E130309F12Rik_chr4_49039155_F Primer3: not found at this Tm N.d. 0.68
mm4_intergenic_Gm12442|E130309F12Rik_chr4_49039155_R Primer3: not found at this Tm N.d. 0.68
mm4_intergenic_Retnlb|Retnla_chr16_48838852_F Primer3: not found at this Tm N.d. 0.62
mm4_intergenic_Retnlb|Retnla_chr16_48838852_R Primer3: not found at this Tm N.d. 0.62
mm4_exon_Adcy3_chr12_4200930_F Primer3: not found at this Tm N.d. 0.51
mm4_exon_Adcy3_chr12_4200930_R Primer3: not found at this Tm N.d. 0.51
mm4_intergenic_Gm26772|Zmiz1_chr14_25560071_F Primer3: not found at this Tm N.d. 0.46
mm4_intergenic_Gm26772|Zmiz1_chr14_25560071_R Primer3: not found at this Tm N.d. 0.46
mm3_intergenic_Gm24304|Gm22974_chr5_80550465_F Primer3: not found at this Tm N.d. 0.39
mm3_intergenic_Gm24304|Gm22974_chr5_80550465_R Primer3: not found at this Tm N.d. 0.39
mm4_intron_Thsd7b_chr1_129895331_F Primer3: not found at this Tm N.d. 0.35
mm4_intron_Thsd7b_chr1_129895331_R Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Nudt10|Bmp15_chrX_6312445_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Nudt10|Bmp15_chrX_6312445_R Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm9915|2610017I09Rik_chr1_42359948_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm9915|2610017I09Rik_chr1_42359948_R Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm11042|Kcnh5_chr12_74836801_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm11042|Kcnh5_chr12_74836801_R Primer3: not found at this Tm N.d. 0.35
mm4_intron_Zc3h12b_chrX_95868422_F Primer3: not found at this Tm N.d. 0.34
mm4_intron_Zc3h12b_chrX_95868422_R Primer3: not found at this Tm N.d. 0.34
mm4_intergenic_Dcx|Gm15048_chrX_144008163_F Primer3: not found at this Tm N.d. 0.34
mm4_intergenic_Dcx|Gm15048_chrX_144008163_R Primer3: not found at this Tm N.d. 0.34
mm4_intergenic_Zbtb46|Abhd16b_chr2_181480486_F Primer3: not found at this Tm N.d. 0.33
mm4_intergenic_Zbtb46|Abhd16b_chr2_181480486_R Primer3: not found at this Tm N.d. 0.33
mm4_intergenic_Gm24467|Gm13456_chr2_40501254_F Primer3: not found at this Tm N.d. 0.33
mm4_intergenic_Gm24467|Gm13456_chr2_40501254_R Primer3: not found at this Tm N.d. 0.33
mm3_intron_Gm2716_chr8_88077442_F Primer3: not found at this Tm N.d. 0.31
mm3_intron_Gm2716_chr8_88077442_R Primer3: not found at this Tm N.d. 0.31
mm4_intergenic_Psg29|Gm24520_chr7_17609682_F Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Psg29|Gm24520_chr7_17609682_R Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Pold2|Myl7_chr11_5889691_F Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Pold2|Myl7_chr11_5889691_R Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Gm6917|Gm6910_chr13_65916723_F Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_Gm6917|Gm6910_chr13_65916723_R Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_Gm15501|Gm5899_chr7_94132075_F Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_Gm15501|Gm5899_chr7_94132075_R Primer3: not found at this Tm N.d. 0.28
mm4_intron_Cant1_chr11_118410749_F Primer3: not found at this Tm N.d. 0.26
mm4_intron_Cant1_chr11_118410749_R Primer3: not found at this Tm N.d. 0.26
mm4_intron_Umod_chr7_119474613_F Primer3: not found at this Tm N.d. 0.25
mm4_intron_Umod_chr7_119474613_R Primer3: not found at this Tm N.d. 0.25
mm4_intergenic_Gm22594|1110002J07Rik_chr10_66596266_F Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Gm22594|1110002J07Rik_chr10_66596266_R Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Gm23043|Gm24943_chr4_51747087_F Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Gm23043|Gm24943_chr4_51747087_R Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Mtpn|Gm23273_chr6_35846130_F Primer3: not found at this Tm N.d. 0.21
mm4_intergenic_Mtpn|Gm23273_chr6_35846130_R Primer3: not found at this Tm N.d. 0.21
mm4_intergenic_Gm11197|Fam58b_chr11_78741008_F Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Gm11197|Fam58b_chr11_78741008_R Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Gm11418|5530401A14Rik_chr11_81649160_F Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Gm11418|5530401A14Rik_chr11_81649160_R Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Gm9162|Scgb2b19_chr7_33212656_F Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Gm9162|Scgb2b19_chr7_33212656_R Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Gm9135|Scgb2b12_chr7_32249779_F Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Gm9135|Scgb2b12_chr7_32249779_R Primer3: not found at this Tm N.d. 0.19
mm4_intron_Grm5_chr7_88068777_F Primer3: not found at this Tm N.d. 0.18
mm4_intron_Grm5_chr7_88068777_R Primer3: not found at this Tm N.d. 0.18
mm4_intron_Nudt9_chr5_104062132_F Primer3: not found at this Tm N.d. 0.17
mm4_intron_Nudt9_chr5_104062132_R Primer3: not found at this Tm N.d. 0.17
mm4_intron_Agbl1_chr7_76690337_F Primer3: not found at this Tm N.d. 0.17
mm4_intron_Agbl1_chr7_76690337_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Tmco5b|Fmn1_chr2_113313037_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Tmco5b|Fmn1_chr2_113313037_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Slitrk1|Gm25901_chr14_109249073_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Slitrk1|Gm25901_chr14_109249073_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Pdcd1|Gm23389_chr1_94514129_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Pdcd1|Gm23389_chr1_94514129_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Olfr1008|Olfr1009_chr2_85691498_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Olfr1008|Olfr1009_chr2_85691498_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Irx1|Rpl9-ps4_chr13_71988489_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Irx1|Rpl9-ps4_chr13_71988489_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm9436|Gm5755_chrX_17810299_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm9436|Gm5755_chrX_17810299_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm6984|Htr2a_chr14_74258090_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm6984|Htr2a_chr14_74258090_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm5506|Gm5839_chr18_48494015_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm5506|Gm5839_chr18_48494015_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm26972|Gm23581_chr18_63487023_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm26972|Gm23581_chr18_63487023_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm24686|Zfp804b_chr5_6747678_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm24686|Zfp804b_chr5_6747678_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm23891|1700018B24Rik_chr3_48255047_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm23891|1700018B24Rik_chr3_48255047_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm23443|Gm12640_chr4_93555526_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm23443|Gm12640_chr4_93555526_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm22347|Gm23764_chr14_102775657_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm22347|Gm23764_chr14_102775657_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm14776|Il1rapl1_chrX_87861306_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm14776|Il1rapl1_chrX_87861306_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm14469|Gm14465_chr2_79110289_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm14469|Gm14465_chr2_79110289_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm12015|Gm23959_chr11_17536995_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm12015|Gm23959_chr11_17536995_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm11218|Gm11219_chr4_64872759_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm11218|Gm11219_chr4_64872759_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Glt1d1|Tmem132d_chr5_127739491_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Glt1d1|Tmem132d_chr5_127739491_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_4931417E11Rik|Gm26179_chr6_74287059_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_4931417E11Rik|Gm26179_chr6_74287059_R Primer3: not found at this Tm N.d. 0.17
mm4_exon_Fbxl17_chr17_63499905_F Primer3: not found at this Tm N.d. 0.17
mm4_exon_Fbxl17_chr17_63499905_R Primer3: not found at this Tm N.d. 0.17
mm3_intron_Peg3_chr7_6730093_F Primer3: not found at this Tm N.d. 0.17
mm3_intron_Peg3_chr7_6730093_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm5394|Gm25825_chrX_121205818_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm5394|Gm25825_chrX_121205818_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm22797|Robo1_chr16_72288918_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm22797|Robo1_chr16_72288918_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Frk|Gm26341_chr10_34789185_F Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Frk|Gm26341_chr10_34789185_R Primer3: not found at this Tm N.d. 0.17
mm3_intergenic_Gm26076|Gm25519_chr3_110906895_F Primer3: not found at this Tm N.d. 0.17
mm3_intergenic_Gm26076|Gm25519_chr3_110906895_R Primer3: not found at this Tm N.d. 0.17
mm3_intergenic_Gm23838|Gm25233_chr5_6208472_F Primer3: not found at this Tm N.d. 0.17
mm3_intergenic_Gm23838|Gm25233_chr5_6208472_R Primer3: not found at this Tm N.d. 0.17
mm4_intergenic_Gm26119|Fzd8_chr18_8780700_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Gm26119|Fzd8_chr18_8780700_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Pcdh17|Gm23926_chr14_85548658_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Pcdh17|Gm23926_chr14_85548658_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Olfr746|Olfr747_chr14_50678755_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Olfr746|Olfr747_chr14_50678755_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Lrp1b|Gm13462_chr2_40936620_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Lrp1b|Gm13462_chr2_40936620_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Gm24464|Psg19_chr7_18770993_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Gm24464|Psg19_chr7_18770993_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_AC161571.1|Gm25956_chr7_54042862_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_AC161571.1|Gm25956_chr7_54042862_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Gm22016|Cdc73_chr1_143474468_F Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Gm22016|Cdc73_chr1_143474468_R Primer3: not found at this Tm N.d. 0.16
mm4_intergenic_Ythdf3|Gm26485_chr3_16230946_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Ythdf3|Gm26485_chr3_16230946_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Il12rb2|Gm4761_chr6_67408549_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Il12rb2|Gm4761_chr6_67408549_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm24297|Gm22911_chr10_38268388_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm24297|Gm22911_chr10_38268388_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm14854|Gm7117_chrX_105709936_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm14854|Gm7117_chrX_105709936_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Cntnap2|Gm25161_chr6_46422135_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Cntnap2|Gm25161_chr6_46422135_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm15762|B230104C08Rik_chr6_147921247_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm15762|B230104C08Rik_chr6_147921247_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Atp2b3|Dusp9_chrX_73595554_F TCGTCGGCAGCGTCGCCTGGAAAGGGCTCTGATA 59.1 0.15
mm4_intergenic_Atp2b3|Dusp9_chrX_73595554_R GTCTCGTGGGCTCGGGCTCACTGTCCCCACAATACT 59.7 0.15
mm4_intergenic_Tspyl5|Mtdh_chr15_33709946_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Tspyl5|Mtdh_chr15_33709946_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm5272|1700008P02Rik_chr3_6549855_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Gm5272|1700008P02Rik_chr3_6549855_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_B430218F22Rik/Mrps30|Fgf10_chr13_118641028_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_B430218F22Rik/Mrps30|Fgf10_chr13_118641028_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Car1|Car3_chr3_14816654_F Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_Car1|Car3_chr3_14816654_R Primer3: not found at this Tm N.d. 0.14
mm3_intron_Lmx1b_chr2_33567117_F TCGTCGGCAGCGTCGATAGCAGTGGGTCATGGGG 59.8 0.14
mm3_intron_Lmx1b_chr2_33567117_R GTCTCGTGGGCTCGGGCGAAGAGCTTTCAAGGCAT 59.1 0.14
mm4_intergenic_Irf2bp1|Foxa3_chr7_19012075_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Irf2bp1|Foxa3_chr7_19012075_R Primer3: not found at this Tm N.d. 0.13
mm4_intron_Trpc7_chr13_56806045_F Primer3: not found at this Tm N.d. 0.13
mm4_intron_Trpc7_chr13_56806045_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_4933428C19Rik|Gm12391_chr4_40624437_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_4933428C19Rik|Gm12391_chr4_40624437_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm24681|Gm23591_chr16_68887145_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm24681|Gm23591_chr16_68887145_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm9144|Apob_chr12_7948826_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm9144|Apob_chr12_7948826_R Primer3: not found at this Tm N.d. 0.12
mm4_intron_Myo3a_chr2_22554142_F Primer3: not found at this Tm N.d. 0.12
mm4_intron_Myo3a_chr2_22554142_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm22827|Gm22181_chr8_112113034_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm22827|Gm22181_chr8_112113034_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Armc2|Gm9855_chr10_42038919_F TCGTCGGCAGCGTCCCTTCCACACAAGCTCCCTT 59.8 0.12
mm4_intergenic_Armc2|Gm9855_chr10_42038919_R GTCTCGTGGGCTCGGGGAGAAGTCGGGGAAGCAAA 59.9 0.12
mm4_intron_Cntn5_chr9_10028266_F Primer3: not found at this Tm N.d. 0.12
mm4_intron_Cntn5_chr9_10028266_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm9578|Gm22891_chr14_81535134_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm9578|Gm22891_chr14_81535134_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm6433|Gm16035_chr5_141285341_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Gm6433|Gm16035_chr5_141285341_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Col6a3|Mlph_chr1_90906987_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Col6a3|Mlph_chr1_90906987_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Gm11901|Gm25173_chr4_27630707_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Gm11901|Gm25173_chr4_27630707_R Primer3: not found at this Tm N.d. 0.11
mm2_intergenic_Glrx3|Gm25798_chr7_137784584_F TCGTCGGCAGCGTCAAAAGGCCGGAGAAGACAGC 60.6 0.10
mm2_intergenic_Glrx3|Gm25798_chr7_137784584_R GTCTCGTGGGCTCGGAACAAGTCCCCACTAGTGCG 59.9 0.10
mm4_intron_Oxct1_chr15_4138753_F Primer3: not found at this Tm N.d. 0.10
mm4_intron_Oxct1_chr15_4138753_R Primer3: not found at this Tm N.d. 0.10
mm4_intron_Gabpb1_chr2_126674722_F TCGTCGGCAGCGTCCAACAGCACACTCAACACCG 59.9 0.10
mm4_intron_Gabpb1_chr2_126674722_R GTCTCGTGGGCTCGGCCATTCTCAGTGGCCGAGAC 60.4 0.10
mm4_exon_Megf11_chr9_64501521_F Primer3: not found at this Tm N.d. 0.09
mm4_exon_Megf11_chr9_64501521_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Hmgb1-ps2|Gm15061_chrX_146203866_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Hmgb1-ps2|Gm15061_chrX_146203866_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm8677|Gm4201_chr7_22538302_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm8677|Gm4201_chr7_22538302_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm8653|Gm8453_chr7_22204769_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm8653|Gm8453_chr7_22204769_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm5726|Gm4141_chr7_20549172_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm5726|Gm4141_chr7_20549172_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm11988|Gm11989_chr11_8134120_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm11988|Gm11989_chr11_8134120_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Mib1|1010001N08Rik_chr18_10975206_F TCGTCGGCAGCGTCAAAGGAGTCCCATGTGCAGG 59.9 0.09
mm4_intergenic_Mib1|1010001N08Rik_chr18_10975206_R GTCTCGTGGGCTCGGGTCCCCACAGTGGCTTCTTT 60.1 0.09
mm4_intron_Kcns1_chr2_164170491_F Primer3: not found at this Tm N.d. 0.08
mm4_intron_Kcns1_chr2_164170491_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Chst11|1700025N21Rik_chr10_83121180_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Chst11|1700025N21Rik_chr10_83121180_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Gm25637|Aqp3_chr4_41070521_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Gm25637|Aqp3_chr4_41070521_R Primer3: not found at this Tm N.d. 0.08
mm4_intron_Exoc6b_chr6_84937539_F Primer3: not found at this Tm N.d. 0.07
mm4_intron_Exoc6b_chr6_84937539_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Rpl21-ps5|Gm24508_chr16_83429550_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Rpl21-ps5|Gm24508_chr16_83429550_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Pkhd1|Mir206_chr1_20650507_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Pkhd1|Mir206_chr1_20650507_R Primer3: not found at this Tm N.d. 0.07
mm4_intron_Supt3_chr17_44926946_F Primer3: not found at this Tm N.d. 0.07
mm4_intron_Supt3_chr17_44926946_R Primer3: not found at this Tm N.d. 0.07
mm4_intron_Cyp2c69_chr19_39853656_F Primer3: not found at this Tm N.d. 0.07
mm4_intron_Cyp2c69_chr19_39853656_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Usp15/AC158802.1|Fam19a2_chr10_123246875_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Usp15/AC158802.1|Fam19a2_chr10_123246875_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Phkb|Gm23904_chr8_86094899_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Phkb|Gm23904_chr8_86094899_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Olfr473|Olfr474_chr7_107949340_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Olfr473|Olfr474_chr7_107949340_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm26108|Pou3f4_chrX_110706028_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm26108|Pou3f4_chrX_110706028_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm25144|Gm23147_chr3_5922889_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm25144|Gm23147_chr3_5922889_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm4991|Gm7134_chrX_110304704_F TCGTCGGCAGCGTCAGGCAAACTCAACCTCACCT 59.1 0.07
mm4_intergenic_Gm4991|Gm7134_chrX_110304704_R GTCTCGTGGGCTCGGAAAATGCTTCTCTGCGAGCT 58.1 0.07
mm4_intergenic_Zcchc6|Gas1_chr13_60031795_F Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Zcchc6|Gas1_chr13_60031795_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_AI846148|Rab11b-ps2_chr19_7392952_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_AI846148|Rab11b-ps2_chr19_7392952_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Mrgpra3|Gm22427_chr7_47614715_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Mrgpra3|Gm22427_chr7_47614715_R Primer3: not found at this Tm N.d. 0.05
mm4_exon_Sh3tc1_chr5_35699835_F Primer3: not found at this Tm N.d. 0.05
mm4_exon_Sh3tc1_chr5_35699835_R Primer3: not found at this Tm N.d. 0.05
mm4_intron_Tfdp1_chr8_13369699_F TCGTCGGCAGCGTCGGGTCCCTGAGCAGAGAGA 59.9 0.04
mm4_intron_Tfdp1_chr8_13369699_R GTCTCGTGGGCTCGGATAGAGCCCTGGTGTTGGAC 59.0 0.04
mm4_intergenic_Galnt14|Ehd3_chr17_73739937_F Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Galnt14|Ehd3_chr17_73739937_R Primer3: not found at this Tm N.d. 0.03
mm4_exon_Tacc2_chr7_130622654_F TCGTCGGCAGCGTCTACCACAGCACCAGCAAACA 60.1 0.03
mm4_exon_Tacc2_chr7_130622654_R GTCTCGTGGGCTCGGGCCACACAGACAACTTGCTG 59.9 0.03
mm4_exon_Dnajb5_chr4_42949874_F Primer3: not found at this Tm N.d. 0.02
mm4_exon_Dnajb5_chr4_42949874_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Hsd11b1|1600010F14Rik_chr1_193251629_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Hsd11b1|1600010F14Rik_chr1_193251629_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Tbx19|Sft2d2_chr1_165165247_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Tbx19|Sft2d2_chr1_165165247_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_4930529M08Rik_chr2_146025195_F Primer3: not found at this Tm N.d. 0.01
mm4_intron_4930529M08Rik_chr2_146025195_R Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Ankef1|Snap25_chr2_136678797_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ankef1|Snap25_chr2_136678797_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Nucb2_chr7_116539058_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Nucb2_chr7_116539058_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Dhodh_chr8_109600932_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Dhodh_chr8_109600932_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Atcay_chr10_81230292_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Atcay_chr10_81230292_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Alox5ap_chr5_149285701_F TCGTCGGCAGCGTCTTCGCACAGCCTTGATTCCT 59.9 0.00
mm4_intron_Alox5ap_chr5_149285701_R GTCTCGTGGGCTCGGGCCTGGGAAGTCAGACCTAC 59.4 0.00
mm4_intron_Aatk_chr11_120020728_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Aatk_chr11_120020728_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Prlhr|Cacul1_chr19_60486341_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Prlhr|Cacul1_chr19_60486341_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Nkx1-1|Fam53a_chr5_33483866_F TCGTCGGCAGCGTCTGCTTCTTGGTCAGCCCTG 59.9 0.00
mm4_intergenic_Nkx1-1|Fam53a_chr5_33483866_R GTCTCGTGGGCTCGGATGGCAGCTCTACCCTCAGT 60.3 0.00
mm4_intergenic_Grxcr2|Sh3rf2_chr18_42023483_F TCGTCGGCAGCGTCGGATGGTCTCAAGCTTTGCC 59.1 0.00
mm4_intergenic_Grxcr2|Sh3rf2_chr18_42023483_R GTCTCGTGGGCTCGGGTCACACTCAGCATCTGCCT 60.0 0.00
mm4_intergenic_Gm23674|Gm26106_chr18_26602090_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm23674|Gm26106_chr18_26602090_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11466|Gm11467_chr2_166204930_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11466|Gm11467_chr2_166204930_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Nod2_chr8_88664415_F TCGTCGGCAGCGTCCGCTCCTCAGGAAGTTCGTT 60.0 0.00
mm4_exon_Nod2_chr8_88664415_R GTCTCGTGGGCTCGGGTGGCTTGGATCAGCTGGAT 60.1 0.00
mm4_exon_Mocos_chr18_24653709_F Primer3: not found at this Tm N.d. 0.00
mm4_exon_Mocos_chr18_24653709_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Megf8_chr7_25353741_F Primer3: not found at this Tm N.d. 0.00
mm4_exon_Megf8_chr7_25353741_R Primer3: not found at this Tm N.d. 0.00

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314226 AGAAATCGAGGTGAGCTGCACCCCAGACTGCGCCACCGGGAACGCCGAGTACCAGCACAGCAAAGGTAGCCACCTTGCCC
CTCCGCTCCCCGGTCCGCCCACTCCACCCACAGTTCCCTTC
mm4_intergenic_Atp2b3|Dusp9_chrX_73595554 GCCTGGAAAGGGCTCTGATAGTTCCAGGTGCAGCAGACTGTGGCTGCTTCTGCAATAACCCCTTATTTTCTCCCAATTTT
TTGTAATTTAACAGATCACAAGGTCACCTCAACAAATCAGTATTGTGGGGACAGTGAGC
mm3_intron_Lmx1b_chr2_33567117 GATAGCAGTGGGTCATGGGGGAGGAACAGACCCACAATAAGCAAAAGGGGGGCGTTGGCCCCAGACTGCCCCACCCAGAA
C
CCCTCACCTTCCGACAGGGCTTGGAGGAGACCTCAAAGGATGCCTTGAAAGCTCTTCGC
mm4_intergenic_Armc2|Gm9855_chr10_42038919 CCTTCCACACAAGCTCCCTTCATTCTCCCTAGCTTCCTGCCCGCTCGCTCCCCGCTCACTCCCTGCTTTTCTCACACCAC
AGACTTCGACATCAGGAAC
GGCCTTGACTTTGCTTCCCCGACTTCTCC
mm2_intergenic_Glrx3|Gm25798_chr7_137784584 AAAAGGCCGGAGAAGACAGCAGCTCCTACTTCAGACTGCTCCACAGGGAACAAATGGAGAGGAGGGCGCACTAGTGGGGA
CTTGTT
mm4_intron_Gabpb1_chr2_126674722 CAACAGCACACTCAACACCGATCTGTGCCCAGGCAAGACATGACCGACGAAACTCGCGGCTTCTTTCCGCACCCGCGCTC
GCGTGGGTTCCGGTGGCGAAGTCTCCGGGGCAAAAGTCTCGGCCACTGAGAATGG
mm4_intergenic_Mib1|1010001N08Rik_chr18_10975206 AAAGGAGTCCCATGTGCAGGAGAGGAGGAAACTGGCTCTCCAGACAGTTAGCCCTCTGGCCCACAGACTGCAGCACCGGA
CAC
AGGCAAGGAGTCCAAAACCAACCAGGACAGTGGAGAAAAGAAGCCACTGTGGGGAC
mm4_intergenic_Gm4991|Gm7134_chrX_110304704 AGGCAAACTCAACCTCACCTCTTACCTTAGGTTAAGACATACAGTAAGTTCAAACCACAGACTGAGACACTGAGAACAGC
TCGCAGAGAAGCATTTT
mm4_intron_Tfdp1_chr8_13369699 GGGTCCCTGAGCAGAGAGAGCGCAGGGCTCCCATCTCACCTCTGACTGGGCCACAGAGAACACCGGTCACTAATACGACA
CAAACGCTTAGAAAGTGTCAGAAGATCTGATCTCTACCAGGTCCAACACCAGGGCTCTAT
mm4_exon_Tacc2_chr7_130622654 TACCACAGCACCAGCAAACAGTGGCTCCTGGAAAGAGACTCTGGACACCAGCGATGCTCAGAGGCAACCACAGACAGGGA
CATCGGGAAC
TGAGCTCCAGCAAGTTGTCTGTGTGGC
mm4_intron_Alox5ap_chr5_149285701 TTCGCACAGCCTTGATTCCTAGGGGTGTTTTAGCACACCGGGCTGTACACTGCTTGCACCTGCACGCCCAGCTGTTCTCC
GTGGTGGAGTCTGGGG
CGGCAATAACTTTTTAGGTAGGTCTGACTTCCCAGGC
mm4_intergenic_Nkx1-1|Fam53a_chr5_33483866 TGCTTCTTGGTCAGCCCTGGCTCCCAGTGGCCCACTCTGAGGCAGGCAGAGACACAATATGGACGCAGTGTGTGAATTTA
AGGAACATTGCACAATTCTACAGCTAAAGATCGAGTCTTCACTGAGGGTAGAGCTGCCAT
mm4_intergenic_Grxcr2|Sh3rf2_chr18_42023483 GGATGGTCTCAAGCTTTGCCCTTCCTGGTGGCCCACTCTGTGGTATTGGCTGAATTTTGACATTTATTTCTGATCCTTAA
CCAAACTACTCTCTTCCATCCCAATTCTTGGTAGTTCTAGAGGCAGATGCTGAGTGTGAC
mm4_exon_Nod2_chr8_88664415 CGCTCCTCAGGAAGTTCGTTCGCACAGAGTTGCAACTGAAGGGCTTCTCTGAAGAGGGCATCCAACTGTACCTGAGAAAG
CACCACCGGGAAC
CTGGGGTGGCAGACCGCCTCATCCAGCTGATCCAAGCCAC

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.

After sequencing, run CRISPRessoPooled. The tool will map the reads to the amplicons and analyse the mutations:
CRISPRessoPooled -r1 Reads1.fastq.gz -r2 Reads2.fastq.gz -f crisporAmplicons_mN1FkRligAThyqKv3eg3.txt --name MY_EXPERIMENT

Version 5.01 - Documentation  - Contact us - Downloads/local installation - Citation - License
CRISPR/Cas9 Guide Designer for chordate vertebrate ecdysozoans lophotrochozoans protostomes spongi corals plants butterflies metazoans genomes fruitflies insects nematodes mammals.