← return to the list of all guides

Contents:

PCR primers for off-targets of GCGGACAGCCTCTCTGGCCA AGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Maximum amplicon length:     Primer Tm:

NamePrimer Sequence Tm CFD Score
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314144_F TCGTCGGCAGCGTCGTCGATGGACTAGCAGGCAG 60.2 1.00
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314144_R GTCTCGTGGGCTCGGTCGGTGTCTGAGCTACTAGGT 59.7 1.00
mm3_intron_Adcy2_chr13_68733470_F TCGTCGGCAGCGTCTGATTCACTCTGTGGGCTGG 59.6 0.78
mm3_intron_Adcy2_chr13_68733470_R GTCTCGTGGGCTCGGCAGCAGATGGAGCCTAGCTG 60.2 0.78
mm4_intron_Lbp_chr2_158308575_F Primer3: not found at this Tm N.d. 0.65
mm4_intron_Lbp_chr2_158308575_R Primer3: not found at this Tm N.d. 0.65
mm2_intron_Dagla_chr19_10280444_F TCGTCGGCAGCGTCGCTCTGTTCCTGTCCATGGT 59.6 0.62
mm2_intron_Dagla_chr19_10280444_R GTCTCGTGGGCTCGGGACAACAGCAGAAGCAGCAC 60.0 0.62
mm4_intron_Jph3_chr8_121740566_F Primer3: not found at this Tm N.d. 0.54
mm4_intron_Jph3_chr8_121740566_R Primer3: not found at this Tm N.d. 0.54
mm3_intron_Kcnd3_chr3_105495625_F Primer3: not found at this Tm N.d. 0.54
mm3_intron_Kcnd3_chr3_105495625_R Primer3: not found at this Tm N.d. 0.54
mm4_intron_Mgll_chr6_88756795_F TCGTCGGCAGCGTCGTGTGGCTGGCAGGATACC 60.4 0.50
mm4_intron_Mgll_chr6_88756795_R GTCTCGTGGGCTCGGTGCATTCTCGATCATCCCCG 59.9 0.50
mm4_intron_AW121686_chr15_82984652_F Primer3: not found at this Tm N.d. 0.42
mm4_intron_AW121686_chr15_82984652_R Primer3: not found at this Tm N.d. 0.42
mm4_intron_Armc9_chr1_86227331_F Primer3: not found at this Tm N.d. 0.42
mm4_intron_Armc9_chr1_86227331_R Primer3: not found at this Tm N.d. 0.42
mm4_intron_Pdzrn4_chr15_92577093_F Primer3: not found at this Tm N.d. 0.40
mm4_intron_Pdzrn4_chr15_92577093_R Primer3: not found at this Tm N.d. 0.40
mm4_intergenic_Gadd45g|Gm26651_chr13_51919883_F Primer3: not found at this Tm N.d. 0.36
mm4_intergenic_Gadd45g|Gm26651_chr13_51919883_R Primer3: not found at this Tm N.d. 0.36
mm4_intergenic_Adck3|Psen2_chr1_180216477_F TCGTCGGCAGCGTCAGGGCATCAATTCCTCAGCC 60.1 0.36
mm4_intergenic_Adck3|Psen2_chr1_180216477_R GTCTCGTGGGCTCGGAGGGGCATGATGCTTCTTCC 60.1 0.36
mm4_intron_Jakmip3_chr7_139029354_F Primer3: not found at this Tm N.d. 0.36
mm4_intron_Jakmip3_chr7_139029354_R Primer3: not found at this Tm N.d. 0.36
mm4_exon_Spta1_chr1_174230678_F Primer3: not found at this Tm N.d. 0.36
mm4_exon_Spta1_chr1_174230678_R Primer3: not found at this Tm N.d. 0.36
mm4_intergenic_Gm15323|Ankrd55_chr13_112030285_F Primer3: not found at this Tm N.d. 0.34
mm4_intergenic_Gm15323|Ankrd55_chr13_112030285_R Primer3: not found at this Tm N.d. 0.34
mm3_intergenic_Uri1|Ccne1_chr7_38074854_F TCGTCGGCAGCGTCTCATCAAAGGCTCCATCGGG 59.8 0.34
mm3_intergenic_Uri1|Ccne1_chr7_38074854_R GTCTCGTGGGCTCGGATAGAGCTTGGAGGGGTCCC 60.4 0.34
mm4_intron_A430093F15Rik_chr19_10780839_F Primer3: not found at this Tm N.d. 0.33
mm4_intron_A430093F15Rik_chr19_10780839_R Primer3: not found at this Tm N.d. 0.33
mm4_intron_Tns3_chr11_8517007_F Primer3: not found at this Tm N.d. 0.33
mm4_intron_Tns3_chr11_8517007_R Primer3: not found at this Tm N.d. 0.33
mm4_intergenic_Glt1d1|Tmem132d_chr5_127760180_F Primer3: not found at this Tm N.d. 0.31
mm4_intergenic_Glt1d1|Tmem132d_chr5_127760180_R Primer3: not found at this Tm N.d. 0.31
mm4_intergenic_Rilpl2|Gm15621_chr5_124472224_F Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Rilpl2|Gm15621_chr5_124472224_R Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Zfp955a|Olfr63_chr17_33268108_F Primer3: not found at this Tm N.d. 0.30
mm4_intergenic_Zfp955a|Olfr63_chr17_33268108_R Primer3: not found at this Tm N.d. 0.30
mm4_exon_Lmf2_chr15_89353055_F Primer3: not found at this Tm N.d. 0.29
mm4_exon_Lmf2_chr15_89353055_R Primer3: not found at this Tm N.d. 0.29
mm4_exon_2900026A02Rik_chr5_113088686_F Primer3: not found at this Tm N.d. 0.28
mm4_exon_2900026A02Rik_chr5_113088686_R Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_Gm13888|AI314831_chr2_105050801_F TCGTCGGCAGCGTCCCACAAGTCCAGCCCATGAT 60.0 0.27
mm4_intergenic_Gm13888|AI314831_chr2_105050801_R GTCTCGTGGGCTCGGGGGGCTTCTGGCTTCTGAAA 60.2 0.27
mm4_intergenic_Wnt2b|Cttnbp2nl_chr3_104971038_F Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Wnt2b|Cttnbp2nl_chr3_104971038_R Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Gm22696|Fut8_chr12_77190909_F Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Gm22696|Fut8_chr12_77190909_R Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Gm22084|Gm24502_chr5_75374815_F Primer3: not found at this Tm N.d. 0.26
mm4_intergenic_Gm22084|Gm24502_chr5_75374815_R Primer3: not found at this Tm N.d. 0.26
mm4_intron_Aig1_chr10_13811179_F Primer3: not found at this Tm N.d. 0.26
mm4_intron_Aig1_chr10_13811179_R Primer3: not found at this Tm N.d. 0.26
mm4_intron_Ephb2_chr4_136760881_F TCGTCGGCAGCGTCGCACAATAGAGTGGGGTGCT 60.0 0.25
mm4_intron_Ephb2_chr4_136760881_R GTCTCGTGGGCTCGGCTTCGTGAGGTCAGAGCTGG 60.1 0.25
mm4_intron_Loxhd1_chr18_77365909_F TCGTCGGCAGCGTCAGATGGCTAACGGACAGGGA 60.3 0.24
mm4_intron_Loxhd1_chr18_77365909_R GTCTCGTGGGCTCGGCGCTTCCTTCTCATCCCCAT 59.5 0.24
mm4_intron_Mpp2_chr11_102087005_F TCGTCGGCAGCGTCCCAGTGTCCCCTCTGTCAAC 59.9 0.22
mm4_intron_Mpp2_chr11_102087005_R GTCTCGTGGGCTCGGAAGAGGAACCACAGCAAGCA 59.8 0.22
mm4_intergenic_Gm23677|Maf_chr8_115674402_F TCGTCGGCAGCGTCTGCATTCCCGGTGAGTACAC 60.0 0.22
mm4_intergenic_Gm23677|Maf_chr8_115674402_R GTCTCGTGGGCTCGGCATCGACTGGTGGGTAGAGC 59.8 0.22
mm4_intron_Ttll7_chr3_146854909_F TCGTCGGCAGCGTCCCAGAGACGTCTTCAGCACA 59.6 0.21
mm4_intron_Ttll7_chr3_146854909_R GTCTCGTGGGCTCGGAACAGACCTCATGCCTGACA 58.9 0.21
mm4_intergenic_Sh2b1|Tufm_chr7_126487290_F Primer3: not found at this Tm N.d. 0.21
mm4_intergenic_Sh2b1|Tufm_chr7_126487290_R Primer3: not found at this Tm N.d. 0.21
mm4_intergenic_Lemd2|mmu-mir-7216_chr17_27320767_F Primer3: not found at this Tm N.d. 0.21
mm4_intergenic_Lemd2|mmu-mir-7216_chr17_27320767_R Primer3: not found at this Tm N.d. 0.21
mm4_intron_Phlpp2_chr8_109888974_F Primer3: not found at this Tm N.d. 0.21
mm4_intron_Phlpp2_chr8_109888974_R Primer3: not found at this Tm N.d. 0.21
mm3_intron_Plekhg5_chr4_152078548_F TCGTCGGCAGCGTCAGCTTATGTGCTGGAACGGT 59.6 0.19
mm3_intron_Plekhg5_chr4_152078548_R GTCTCGTGGGCTCGGTCTAACCAACACCCTGCCAC 59.8 0.19
mm4_intron_Suclg2_chr6_95675260_F Primer3: not found at this Tm N.d. 0.19
mm4_intron_Suclg2_chr6_95675260_R Primer3: not found at this Tm N.d. 0.19
mm3_intergenic_Gm24503|Ccrn4l_chr3_51115342_F Primer3: not found at this Tm N.d. 0.18
mm3_intergenic_Gm24503|Ccrn4l_chr3_51115342_R Primer3: not found at this Tm N.d. 0.18
mm4_intron_Szrd1_chr4_141124358_F Primer3: not found at this Tm N.d. 0.17
mm4_intron_Szrd1_chr4_141124358_R Primer3: not found at this Tm N.d. 0.17
mm3_intron_Ccdc85a_chr11_28423556_F TCGTCGGCAGCGTCAACCAGCCACTTCAACCACA 60.0 0.17
mm3_intron_Ccdc85a_chr11_28423556_R GTCTCGTGGGCTCGGAGTCTGCATAGAAAACTGACTTCT 57.8 0.17
mm4_intron_Usp24_chr4_106408328_F TCGTCGGCAGCGTCGTGAACTGATGGCCCTGGAG 60.3 0.16
mm4_intron_Usp24_chr4_106408328_R GTCTCGTGGGCTCGGACTCTGGGCAAGTCTGTTGT 59.1 0.16
mm3_intron_Galnt7_chr8_57532936_F TCGTCGGCAGCGTCGACTGAGAGGCACAGAGAGG 59.1 0.16
mm3_intron_Galnt7_chr8_57532936_R GTCTCGTGGGCTCGGTTGAGTCCCCTCCCCAAGAA 60.1 0.16
mm4_intron_Musk_chr4_58315643_F Primer3: not found at this Tm N.d. 0.16
mm4_intron_Musk_chr4_58315643_R Primer3: not found at this Tm N.d. 0.16
mm4_intron_Ntn5_chr7_45689382_F Primer3: not found at this Tm N.d. 0.15
mm4_intron_Ntn5_chr7_45689382_R Primer3: not found at this Tm N.d. 0.15
mm4_intron_Itpr2_chr6_146397479_F Primer3: not found at this Tm N.d. 0.15
mm4_intron_Itpr2_chr6_146397479_R Primer3: not found at this Tm N.d. 0.15
mm3_intergenic_Gm26011|Fam19a1_chr6_96624163_F Primer3: not found at this Tm N.d. 0.15
mm3_intergenic_Gm26011|Fam19a1_chr6_96624163_R Primer3: not found at this Tm N.d. 0.15
mm3_intron_Supt3_chr17_45003568_F TCGTCGGCAGCGTCAGCTGCCTTCAGATTGCTGT 59.9 0.15
mm3_intron_Supt3_chr17_45003568_R GTCTCGTGGGCTCGGGCACATAGCTTCCCTGGACA 59.7 0.15
mm4_exon_Slc12a9_chr5_137314699_F TCGTCGGCAGCGTCGGGGACACTGAGGTAGCCTA 60.0 0.15
mm4_exon_Slc12a9_chr5_137314699_R GTCTCGTGGGCTCGGGGTCTTCCTCCGCTTCCTTC 60.1 0.15
mm4_exon_Dnah11_chr12_118036441_F TCGTCGGCAGCGTCCAGATCCTGCGGGTTCACAT 60.1 0.14
mm4_exon_Dnah11_chr12_118036441_R GTCTCGTGGGCTCGGGGCCCTCAAACCTTCCATGA 59.9 0.14
mm4_intron_Cdhr2_chr13_54711438_F TCGTCGGCAGCGTCGGCACTACACTGTAGAGGCC 59.8 0.13
mm4_intron_Cdhr2_chr13_54711438_R GTCTCGTGGGCTCGGTAGAGACTCAGCAGGGCGAT 60.1 0.13
mm3_intergenic_Gm24734|Nog_chr11_89264317_F TCGTCGGCAGCGTCCTGCCACCCTACTTGAGCAG 60.3 0.13
mm3_intergenic_Gm24734|Nog_chr11_89264317_R GTCTCGTGGGCTCGGCTCCTGGAATGCCCATCTCC 59.8 0.13
mm4_intron_Trim44_chr2_102387335_F Primer3: not found at this Tm N.d. 0.13
mm4_intron_Trim44_chr2_102387335_R Primer3: not found at this Tm N.d. 0.13
mm4_intron_Astn1_chr1_158469143_F Primer3: not found at this Tm N.d. 0.13
mm4_intron_Astn1_chr1_158469143_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm20672|Abcg2_chr6_58574898_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Gm20672|Abcg2_chr6_58574898_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Itm2b|Med4_chr14_73474440_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Itm2b|Med4_chr14_73474440_R Primer3: not found at this Tm N.d. 0.12
mm2_intergenic_Kcna5|Kcna1_chr6_126558032_F TCGTCGGCAGCGTCCCACACCATCTGCTCCCATT 60.0 0.12
mm2_intergenic_Kcna5|Kcna1_chr6_126558032_R GTCTCGTGGGCTCGGGGTTGGACCCTGACCATCTA 58.4 0.12
mm4_intergenic_Nron|Mvb12b_chr2_33816434_F Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Nron|Mvb12b_chr2_33816434_R Primer3: not found at this Tm N.d. 0.12
mm4_intron_Ascc2_chr11_4644095_F TCGTCGGCAGCGTCTCAGGACCCTACTGAGCCTT 59.5 0.11
mm4_intron_Ascc2_chr11_4644095_R GTCTCGTGGGCTCGGAAACTCCCCACTGCTTTCCC 60.1 0.11
mm4_intergenic_Tsku|Gucy2d_chr7_98367588_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Tsku|Gucy2d_chr7_98367588_R Primer3: not found at this Tm N.d. 0.11
mm3_intergenic_Gm12158|Ebf1_chr11_44820249_F TCGTCGGCAGCGTCAAGCACTGAGTAGGCTCTGC 59.7 0.10
mm3_intergenic_Gm12158|Ebf1_chr11_44820249_R GTCTCGTGGGCTCGGACATCCTAGAATGGCTAAAGGAA 57.0 0.10
mm4_intron_Acan_chr7_79109073_F TCGTCGGCAGCGTCACACCTCTGCTTCTGCCATC 60.0 0.10
mm4_intron_Acan_chr7_79109073_R GTCTCGTGGGCTCGGTGGGCCTCCTTTTCTGCATT 59.8 0.10
mm4_intron_Lmf1_chr17_25607038_F Primer3: not found at this Tm N.d. 0.10
mm4_intron_Lmf1_chr17_25607038_R Primer3: not found at this Tm N.d. 0.10
mm4_intron_Pcdh15_chr10_74373248_F Primer3: not found at this Tm N.d. 0.10
mm4_intron_Pcdh15_chr10_74373248_R Primer3: not found at this Tm N.d. 0.10
mm4_exon_Gls2_chr10_128203609_F Primer3: not found at this Tm N.d. 0.10
mm4_exon_Gls2_chr10_128203609_R Primer3: not found at this Tm N.d. 0.10
mm3_intergenic_Taco1|Map3k3_chr11_106084206_F TCGTCGGCAGCGTCAACTGAGCAGAGGGTTGTGG 59.8 0.09
mm3_intergenic_Taco1|Map3k3_chr11_106084206_R GTCTCGTGGGCTCGGGCCTAGCCAATCACGGAGAG 60.2 0.09
mm4_intergenic_Gm20388/Galnt2|1810008B01Rik/Gm20388/Galnt2_chr8_124301649_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm20388/Galnt2|1810008B01Rik/Gm20388/Galnt2_chr8_124301649_R Primer3: not found at this Tm N.d. 0.09
mm4_intron_E130308A19Rik_chr4_59701707_F Primer3: not found at this Tm N.d. 0.09
mm4_intron_E130308A19Rik_chr4_59701707_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Trib1|Gm7083_chr15_59660169_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Trib1|Gm7083_chr15_59660169_R Primer3: not found at this Tm N.d. 0.08
mm4_intron_Plxna4_chr6_32526431_F Primer3: not found at this Tm N.d. 0.08
mm4_intron_Plxna4_chr6_32526431_R Primer3: not found at this Tm N.d. 0.08
mm3_intergenic_Sptlc1|Msx2_chr13_53430623_F Primer3: not found at this Tm N.d. 0.08
mm3_intergenic_Sptlc1|Msx2_chr13_53430623_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_9530036O11Rik|Rnf32_chr5_29134501_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_9530036O11Rik|Rnf32_chr5_29134501_R Primer3: not found at this Tm N.d. 0.08
mm4_intron_Clcnka_chr4_141392105_F Primer3: not found at this Tm N.d. 0.08
mm4_intron_Clcnka_chr4_141392105_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Commd10|Gm22791_chr18_46975341_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Commd10|Gm22791_chr18_46975341_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Anapc7|Atp2a2_chr5_122448083_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_Anapc7|Atp2a2_chr5_122448083_R Primer3: not found at this Tm N.d. 0.08
mm4_exon_Col27a1_chr4_63331402_F Primer3: not found at this Tm N.d. 0.07
mm4_exon_Col27a1_chr4_63331402_R Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_2310007B03Rik|E030010N08Rik_chr1_93212286_F TCGTCGGCAGCGTCTGAGCCTTGCCTTAAAGCCA 59.8 0.07
mm4_intergenic_2310007B03Rik|E030010N08Rik_chr1_93212286_R GTCTCGTGGGCTCGGGCCCTCCAAATTCTCCAGCA 60.3 0.07
mm3_exon_Prtn3_chr10_79881939_F TCGTCGGCAGCGTCGGAAGAGACGAGTCCTCACG 59.5 0.07
mm3_exon_Prtn3_chr10_79881939_R GTCTCGTGGGCTCGGGACAGAGTCTGGTCCTGCTG 59.7 0.07
mm4_intergenic_Gm15810|Phactr1_chr13_42865944_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm15810|Phactr1_chr13_42865944_R Primer3: not found at this Tm N.d. 0.07
mm3_intron_Stk30_chr12_110827736_F TCGTCGGCAGCGTCTGAACATGGATGGAAAATGCCA 58.8 0.07
mm3_intron_Stk30_chr12_110827736_R GTCTCGTGGGCTCGGCTGCAGCTCAGTCAGGTCTC 60.1 0.07
mm4_intergenic_Gm24981|Gm20667_chr14_67619423_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Gm24981|Gm20667_chr14_67619423_R Primer3: not found at this Tm N.d. 0.07
mm3_intergenic_Lingo1|Odf3l1_chr9_56792589_F TCGTCGGCAGCGTCCTTCCCCACAGCATCAGGAC 60.3 0.06
mm3_intergenic_Lingo1|Odf3l1_chr9_56792589_R GTCTCGTGGGCTCGGGCAGGGGTCAGGGATGAAAT 59.7 0.06
mm4_intron_Usp35_chr7_97319939_F Primer3: not found at this Tm N.d. 0.06
mm4_intron_Usp35_chr7_97319939_R Primer3: not found at this Tm N.d. 0.06
mm4_intron_Tm9sf4_chr2_153164787_F Primer3: not found at this Tm N.d. 0.06
mm4_intron_Tm9sf4_chr2_153164787_R Primer3: not found at this Tm N.d. 0.06
mm4_exon_Gsr_chr8_33681507_F TCGTCGGCAGCGTCCTTCGCTTTCCTTTCAGCCG 59.8 0.06
mm4_exon_Gsr_chr8_33681507_R GTCTCGTGGGCTCGGGGACAGGAGGAGACAGGACT 59.9 0.06
mm4_intron_Armc9_chr1_86236753_F Primer3: not found at this Tm N.d. 0.06
mm4_intron_Armc9_chr1_86236753_R Primer3: not found at this Tm N.d. 0.06
mm4_exon_Nudc_chr4_133535750_F Primer3: not found at this Tm N.d. 0.06
mm4_exon_Nudc_chr4_133535750_R Primer3: not found at this Tm N.d. 0.06
mm3_intron_Sept9_chr11_117313412_F TCGTCGGCAGCGTCTTCCTGGCTGCTTCACTCTG 59.9 0.06
mm3_intron_Sept9_chr11_117313412_R GTCTCGTGGGCTCGGCCAGGTCCTCAACACTGCTT 59.8 0.06
mm4_exon_Kcnip4_chr5_49524781_F Primer3: not found at this Tm N.d. 0.06
mm4_exon_Kcnip4_chr5_49524781_R Primer3: not found at this Tm N.d. 0.06
mm4_intron_Csmd2_chr4_128554379_F Primer3: not found at this Tm N.d. 0.05
mm4_intron_Csmd2_chr4_128554379_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Otud7a|Gm5898_chr7_63448867_F TCGTCGGCAGCGTCCGCTGGCTGGCTTGTACATA 60.4 0.05
mm4_intergenic_Otud7a|Gm5898_chr7_63448867_R GTCTCGTGGGCTCGGCTGGGGCATGATCAAGGTGT 60.0 0.05
mm4_intron_Abcc4_chr14_118690771_F Primer3: not found at this Tm N.d. 0.04
mm4_intron_Abcc4_chr14_118690771_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Aldh1a3|Asb7_chr7_66583000_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Aldh1a3|Asb7_chr7_66583000_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Dhrs3|Vps13d_chr4_144937934_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Dhrs3|Vps13d_chr4_144937934_R Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Ntf3|Kcna5_chr6_126483380_F TCGTCGGCAGCGTCGCTGTCCACCTCCGATTACT 59.1 0.04
mm3_intergenic_Ntf3|Kcna5_chr6_126483380_R GTCTCGTGGGCTCGGTTGTCAAGCCTCACACTCCA 59.1 0.04
mm3_intron_Sorl1_chr9_42111590_F Primer3: not found at this Tm N.d. 0.04
mm3_intron_Sorl1_chr9_42111590_R Primer3: not found at this Tm N.d. 0.04
mm4_intron_Ncor2_chr5_125065559_F Primer3: not found at this Tm N.d. 0.04
mm4_intron_Ncor2_chr5_125065559_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_1700019O17Rik|Ptma_chr1_86506152_F TCGTCGGCAGCGTCCTTGAGTGGGCAAAATGGCT 59.0 0.04
mm4_intergenic_1700019O17Rik|Ptma_chr1_86506152_R GTCTCGTGGGCTCGGTCTCCTGGCCTCCCTAACTC 60.0 0.04
mm3_intron_Stx18_chr5_38063524_F TCGTCGGCAGCGTCTAGCGTTTATCTGGGGCAGG 59.5 0.04
mm3_intron_Stx18_chr5_38063524_R GTCTCGTGGGCTCGGTCCAAAGTCACAGAATGCGGA 59.9 0.04
mm4_intron_Trhde_chr10_114501129_F Primer3: not found at this Tm N.d. 0.03
mm4_intron_Trhde_chr10_114501129_R Primer3: not found at this Tm N.d. 0.03
mm4_intron_Nup188_chr2_30335903_F Primer3: not found at this Tm N.d. 0.03
mm4_intron_Nup188_chr2_30335903_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Hspb1|Ywhag_chr5_135896247_F TCGTCGGCAGCGTCTCCAAACAAGGAGAGTGGGC 59.8 0.03
mm4_intergenic_Hspb1|Ywhag_chr5_135896247_R GTCTCGTGGGCTCGGTCTCCCCAGCACAACCTTTC 59.8 0.03
mm2_intron_Plekhd1_chr12_80715702_F TCGTCGGCAGCGTCTGGGCCTTTCAACAGCTCTT 59.8 0.02
mm2_intron_Plekhd1_chr12_80715702_R GTCTCGTGGGCTCGGGCTCTGCTTTAATACGCATGGT 59.3 0.02
mm4_intergenic_Olfr136|Gm20408_chr17_38349363_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Olfr136|Gm20408_chr17_38349363_R Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Igsf3|Atp1a1_chr3_101471847_F Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Igsf3|Atp1a1_chr3_101471847_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm25779|Gm13173_chr4_153040171_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm25779|Gm13173_chr4_153040171_R Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Adcy9|Srl_chr16_4444566_F Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Adcy9|Srl_chr16_4444566_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Tcf4_chr18_69653312_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Tcf4_chr18_69653312_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Ephb2|C1qb_chr4_136855410_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Ephb2|C1qb_chr4_136855410_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Arhgef11_chr3_87695588_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Arhgef11_chr3_87695588_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Acad10_chr5_121641539_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Acad10_chr5_121641539_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_9530026P05Rik|Gm5313_chr6_93123680_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_9530026P05Rik|Gm5313_chr6_93123680_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm22140|Gm5908_chr8_32274734_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Gm22140|Gm5908_chr8_32274734_R Primer3: not found at this Tm N.d. 0.01
mm4_exon_Vps9d1_chr8_123246905_F Primer3: not found at this Tm N.d. 0.01
mm4_exon_Vps9d1_chr8_123246905_R Primer3: not found at this Tm N.d. 0.01
mm2_exon_Dedd2_chr7_25203638_F TCGTCGGCAGCGTCCCCTCCTTCCTCCTCCATCA 60.0 0.01
mm2_exon_Dedd2_chr7_25203638_R GTCTCGTGGGCTCGGCGTGTTCCTGACTGAGGCTT 59.9 0.01
mm4_intergenic_Olfr337-ps1|Olfr338_chr2_36364211_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr337-ps1|Olfr338_chr2_36364211_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Vmn2r60_chr7_42171496_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Vmn2r60_chr7_42171496_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Trak2_chr1_58931921_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Trak2_chr1_58931921_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Tmem132b_chr5_125721279_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Tmem132b_chr5_125721279_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Tek_chr4_94818334_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Tek_chr4_94818334_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Sybu_chr15_44724274_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Sybu_chr15_44724274_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Stx18_chr5_38133496_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Stx18_chr5_38133496_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Spag16_chr1_70238250_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Spag16_chr1_70238250_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc25a21_chr12_56750994_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc25a21_chr12_56750994_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc17a5_chr9_78566827_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc17a5_chr9_78566827_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Pde4d_chr13_109852908_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Pde4d_chr13_109852908_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Nrg3_chr14_38456256_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Nrg3_chr14_38456256_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Mei4_chr9_81911751_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Mei4_chr9_81911751_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Luzp2_chr7_54944790_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Luzp2_chr7_54944790_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Luzp2_chr7_54941485_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Luzp2_chr7_54941485_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ica1_chr6_8697324_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ica1_chr6_8697324_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Hlcs_chr16_94276050_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Hlcs_chr16_94276050_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gpc6_chr14_117082296_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gpc6_chr14_117082296_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm3164_chr14_4438126_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm3164_chr14_4438126_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm14951_chrX_123259270_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm14951_chrX_123259270_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm13849_chr6_31853186_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm13849_chr6_31853186_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm12132_chr11_40069643_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Gm12132_chr11_40069643_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Fhit_chr14_9729949_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Fhit_chr14_9729949_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Dlg2_chr7_92231204_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Dlg2_chr7_92231204_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Col23a1_chr11_51438883_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Col23a1_chr11_51438883_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Chst9_chr18_15601103_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Chst9_chr18_15601103_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ccdc15_chr9_37332527_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ccdc15_chr9_37332527_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Btbd3_chr2_138579211_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Btbd3_chr2_138579211_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Arhgef38_chr3_133124800_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Arhgef38_chr3_133124800_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_4933406I18Rik_chr7_114405677_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_4933406I18Rik_chr7_114405677_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zfp946|Vmn2r111_chr17_22488710_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zfp946|Vmn2r111_chr17_22488710_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zfp781|Zfp873_chr10_81969063_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zfp781|Zfp873_chr10_81969063_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zcchc6|Gas1_chr13_60027522_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zcchc6|Gas1_chr13_60027522_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Wif1|Tbc1d30_chr10_121165904_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Wif1|Tbc1d30_chr10_121165904_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r-ps2|Gm13506_chr2_39361852_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r-ps2|Gm13506_chr2_39361852_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r-ps118|Vmn2r98_chr17_18994945_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r-ps118|Vmn2r98_chr17_18994945_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn1r168|Vmn1r169_chr7_23557885_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn1r168|Vmn1r169_chr7_23557885_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn1r-ps14|Vmn1r-ps15_chr6_58069681_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn1r-ps14|Vmn1r-ps15_chr6_58069681_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Unc93a|Smok2a_chr17_13159042_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Unc93a|Smok2a_chr17_13159042_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tmem28|Eda_chrX_99907507_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tmem28|Eda_chrX_99907507_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tcam1|Gh_chr11_106296404_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tcam1|Gh_chr11_106296404_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tap2|H2-Ob_chr17_34220605_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Tap2|H2-Ob_chr17_34220605_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Stpg2|mmu-let-7j_chr3_140021109_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Stpg2|mmu-let-7j_chr3_140021109_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Stmnd1|Rbm24_chr13_46382083_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Stmnd1|Rbm24_chr13_46382083_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Shisa9|Gm6327_chr16_12340877_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Shisa9|Gm6327_chr16_12340877_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Sgms1/2700046G09Rik|Rpl9-ps6_chr19_32443033_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Sgms1/2700046G09Rik|Rpl9-ps6_chr19_32443033_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Runx3|Clic4_chr4_135185632_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Runx3|Clic4_chr4_135185632_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpl21-ps14|n-R5s93_chr8_4892044_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpl21-ps14|n-R5s93_chr8_4892044_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpl10l|Mdga2/MDGA2_chr12_66412946_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpl10l|Mdga2/MDGA2_chr12_66412946_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rnpc3|Col11a1_chr3_114020804_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rnpc3|Col11a1_chr3_114020804_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rbm26|Gm22290_chr14_105213033_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rbm26|Gm22290_chr14_105213033_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_RP23-339G10.1|Unc13c_chr9_73406475_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_RP23-339G10.1|Unc13c_chr9_73406475_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pou3f4|Cylc1_chrX_110866724_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pou3f4|Cylc1_chrX_110866724_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pon2|Asb4_chr6_5330824_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pon2|Asb4_chr6_5330824_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pof1b|Gm14922/Gm14923_chrX_112747979_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pof1b|Gm14922/Gm14923_chrX_112747979_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Plod2|Gm9621_chr9_92630297_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Plod2|Gm9621_chr9_92630297_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Plekhm3|Rpl10a-ps1_chr1_64966216_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Plekhm3|Rpl10a-ps1_chr1_64966216_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120223398_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120223398_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pkdcc|Gm24240_chr17_83257221_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pkdcc|Gm24240_chr17_83257221_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Per2|Traf3ip1_chr1_91477136_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Per2|Traf3ip1_chr1_91477136_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pdlim3|Ccdc110_chr8_45923885_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pdlim3|Ccdc110_chr8_45923885_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pcdh17|Gm23926_chr14_85524326_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pcdh17|Gm23926_chr14_85524326_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pard3|mmu-mir-21c_chr8_128090618_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Pard3|mmu-mir-21c_chr8_128090618_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr1177-ps|Olfr1178_chr2_88367984_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr1177-ps|Olfr1178_chr2_88367984_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Myo1f|Zfp414_chr17_33624164_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Myo1f|Zfp414_chr17_33624164_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mmp27|Mmp20_chr9_7611054_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mmp27|Mmp20_chr9_7611054_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mmd|Hlf_chr11_90311259_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mmd|Hlf_chr11_90311259_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mfap3l|Gm23329_chr8_60686607_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Mfap3l|Gm23329_chr8_60686607_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ly96|Gm5828_chr1_16739403_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ly96|Gm5828_chr1_16739403_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Lrrc7|Gm9423_chr3_158879653_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Lrrc7|Gm9423_chr3_158879653_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Kcnh7|Gm23503_chr2_63301552_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Kcnh7|Gm23503_chr2_63301552_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Iyd|Plekhg1_chr10_3606849_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Iyd|Plekhg1_chr10_3606849_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Il1f9|Il1f6_chr2_24194441_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Il1f9|Il1f6_chr2_24194441_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hdhd1a|Prr16_chr18_50633363_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hdhd1a|Prr16_chr18_50633363_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hamp2|Hamp_chr7_30933137_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hamp2|Hamp_chr7_30933137_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Grxcr1|Gm23605_chr5_68414148_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Grxcr1|Gm23605_chr5_68414148_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Grem2|Rgs7_chr1_175047092_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Grem2|Rgs7_chr1_175047092_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9949|Htr4_chr18_62276235_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9949|Htr4_chr18_62276235_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9931|Gm22966_chr1_148173202_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9931|Gm22966_chr1_148173202_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9884|Gm24064_chr1_26415147_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9884|Gm24064_chr1_26415147_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9135|Scgb2b12_chr7_32185764_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9135|Scgb2b12_chr7_32185764_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm8116|Col12a1_chr9_78829209_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm8116|Col12a1_chr9_78829209_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm7191|Gm23494_chr8_98180224_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm7191|Gm23494_chr8_98180224_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6650|Gm24054_chr5_13862917_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6650|Gm24054_chr5_13862917_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6600|Gm8837_chr6_130955843_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6600|Gm8837_chr6_130955843_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6586|Gm10482_chr5_10071838_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm6586|Gm10482_chr5_10071838_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5849|4930529C04Rik_chr3_90995586_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5849|4930529C04Rik_chr3_90995586_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5839|Gm25440_chr18_48711810_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5839|Gm25440_chr18_48711810_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5386|Gm14652_chrX_45646091_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5386|Gm14652_chrX_45646091_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5335|A730056A06Rik_chr7_73180950_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm5335|A730056A06Rik_chr7_73180950_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4822|Tpm3-rs7_chr14_112633646_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4822|Tpm3-rs7_chr14_112633646_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4398|Scgb2b15_chr7_32813857_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4398|Scgb2b15_chr7_32813857_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm382|Gm22139_chrX_127166206_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm382|Gm22139_chrX_127166206_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm3409|Gm3415_chr5_146543199_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm3409|Gm3415_chr5_146543199_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm2933|Gm2964_chrX_33944635_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm2933|Gm2964_chrX_33944635_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm2824|9230109A22Rik_chr15_25052625_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm2824|9230109A22Rik_chr15_25052625_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26901|Sntg1_chr1_8157348_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26901|Sntg1_chr1_8157348_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26782|Klhl33_chr14_50881368_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26782|Klhl33_chr14_50881368_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26490|Gm12605_chr4_89186382_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26490|Gm12605_chr4_89186382_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26327|Gm6851_chr7_39779227_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm26327|Gm6851_chr7_39779227_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25935|Gm22593_chr17_94302257_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25935|Gm22593_chr17_94302257_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25830|4930555F03Rik_chr8_48985335_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25830|4930555F03Rik_chr8_48985335_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25817|Scgb2b17_chr7_33040754_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25817|Scgb2b17_chr7_33040754_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25609|Gm23534_chr1_137277089_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25609|Gm23534_chr1_137277089_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25578|Actr3_chr1_125349276_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25578|Actr3_chr1_125349276_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25509|n-R5-8s1_chr18_73262833_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25509|n-R5-8s1_chr18_73262833_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25422|Tmtc2_chr10_105178274_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25422|Tmtc2_chr10_105178274_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24880|Gm10172_chr7_70759094_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24880|Gm10172_chr7_70759094_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24750|Gm24590_chr12_62536029_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24750|Gm24590_chr12_62536029_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24129|Tecrl_chr5_83139091_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24129|Tecrl_chr5_83139091_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24042|Gm11898_chr4_25852728_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm24042|Gm11898_chr4_25852728_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm23306|Gm4758_chr16_36298942_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm23306|Gm4758_chr16_36298942_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22597|Gm24514_chr18_55315722_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22597|Gm24514_chr18_55315722_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22548|Gm15669_chr1_67757343_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22548|Gm15669_chr1_67757343_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22507|Trhde_chr10_113728602_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22507|Trhde_chr10_113728602_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22429|Gm23659_chr16_65180138_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22429|Gm23659_chr16_65180138_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22331|Gm24937_chr1_113017260_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22331|Gm24937_chr1_113017260_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22217|Gm22448_chr16_66243216_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm22217|Gm22448_chr16_66243216_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm21879|Gm20856_chrY_85094610_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm21879|Gm20856_chrY_85094610_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm21824|Gm21879_chrY_84710180_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm21824|Gm21879_chrY_84710180_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm20909|Gm20865_chrY_21227245_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm20909|Gm20865_chrY_21227245_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm20594|Gm4409_chr6_79904937_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm20594|Gm4409_chr6_79904937_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15189|Rps6ka3_chrX_159151148_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15189|Rps6ka3_chrX_159151148_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15173|Gm23381_chrX_157624605_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15173|Gm23381_chrX_157624605_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14969|Gm7746_chrX_126476375_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14969|Gm7746_chrX_126476375_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14672|Gm14668_chrX_65708078_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14672|Gm14668_chrX_65708078_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14649|Gm14647_chrX_58218967_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14649|Gm14647_chrX_58218967_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14365|Gm9428_chrX_5197261_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14365|Gm9428_chrX_5197261_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13813|Gm13812_chr2_100419539_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13813|Gm13812_chr2_100419539_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13484|Gm13498_chr2_50680778_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13484|Gm13498_chr2_50680778_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13458|Gm13455_chr2_40236748_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13458|Gm13455_chr2_40236748_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13365|Gm13368_chr2_15433844_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13365|Gm13368_chr2_15433844_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12|Gm12355_chr11_98614448_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12|Gm12355_chr11_98614448_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12919|2610301B20Rik_chr4_10870191_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12919|2610301B20Rik_chr4_10870191_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12674|Gm12673_chr4_96155761_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12674|Gm12673_chr4_96155761_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12298|9130409J20Rik_chr11_66953161_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12298|9130409J20Rik_chr11_66953161_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12026|Gm12027_chr11_19569328_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm12026|Gm12027_chr11_19569328_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11923|Gm11925_chr4_29716637_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11923|Gm11925_chr4_29716637_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm10772|Gm26754_chr13_66230395_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm10772|Gm26754_chr13_66230395_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gbe1|Gm24968_chr16_70638473_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gbe1|Gm24968_chr16_70638473_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Dock6|Rab3d_chr9_21880340_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Dock6|Rab3d_chr9_21880340_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_D630032N06Rik|Gm22587_chr11_85291473_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_D630032N06Rik|Gm22587_chr11_85291473_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cyp2d12|AC118710.1_chr15_82596737_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cyp2d12|AC118710.1_chr15_82596737_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Chmp2b|Vgll3_chr16_65790606_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Chmp2b|Vgll3_chr16_65790606_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh9|Gm22032_chr15_17162790_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh9|Gm22032_chr15_17162790_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh13|Hsbp1_chr8_119336899_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh13|Hsbp1_chr8_119336899_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh10|Gm25976_chr15_19050351_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cdh10|Gm25976_chr15_19050351_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccl1|Tmem132e_chr11_82337150_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccl1|Tmem132e_chr11_82337150_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccdc132|Calcr_chr6_3656282_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccdc132|Calcr_chr6_3656282_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cacna1e|Gm9530_chr1_154904874_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cacna1e|Gm9530_chr1_154904874_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_C130026I21Rik|Rpl19-ps1/AC167036.1_chr1_84999381_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_C130026I21Rik|Rpl19-ps1/AC167036.1_chr1_84999381_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_BC030500|Gm24847_chr8_59137709_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_BC030500|Gm24847_chr8_59137709_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Alk|Gm26963_chr17_72616407_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Alk|Gm26963_chr17_72616407_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Akr1c12|Akr1c6_chr13_4339647_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Akr1c12|Akr1c6_chr13_4339647_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ada|Wisp2_chr2_163794927_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ada|Wisp2_chr2_163794927_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_AC124193.1|Lsamp_chr16_41492068_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_AC124193.1|Lsamp_chr16_41492068_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_5033403F01Rik|Gm23972_chr13_39508084_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_5033403F01Rik|Gm23972_chr13_39508084_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_4933411G06Rik|Gm23906_chr10_51884169_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_4933411G06Rik|Gm23906_chr10_51884169_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_4930405D11Rik|Kif2b_chr11_90966092_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_4930405D11Rik|Kif2b_chr11_90966092_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Scube2|Dennd5a_chr7_109865781_F TCGTCGGCAGCGTCTCATTTTCACACGGTCTTCAGT 58.1 0.00
mm4_intergenic_Scube2|Dennd5a_chr7_109865781_R GTCTCGTGGGCTCGGCAAGACTCCGCGAGCGAG 60.5 0.00
mm4_intergenic_Cartpt|Mccc2_chr13_99900868_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Cartpt|Mccc2_chr13_99900868_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Rhoh_chr5_65871312_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Rhoh_chr5_65871312_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Msi2_chr11_88367956_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Msi2_chr11_88367956_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Lrrk1_chr7_66261169_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Lrrk1_chr7_66261169_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zbtb10|Gm22604_chr3_9347112_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Zbtb10|Gm22604_chr3_9347112_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm8623|Ing2_chr8_47659691_F TCGTCGGCAGCGTCTGGAGGTCTGAAGAGAGGCA 59.8 0.00
mm4_intergenic_Gm8623|Ing2_chr8_47659691_R GTCTCGTGGGCTCGGCCCATCGCTCTTGGCCTTTA 60.1 0.00
mm4_intergenic_Gm26601|Dip2c_chr13_9484760_F TCGTCGGCAGCGTCGCAGGATGTCTCATGGCCTT 60.1 0.00
mm4_intergenic_Gm26601|Dip2c_chr13_9484760_R GTCTCGTGGGCTCGGATCCACTTGACCATTGCCCT 59.2 0.00
mm4_intergenic_Gm25382|Cited2_chr10_17653339_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25382|Cited2_chr10_17653339_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm16412|Gm14791_chrX_89017754_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm16412|Gm14791_chrX_89017754_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14061|Mir1952_chr2_138775067_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm14061|Mir1952_chr2_138775067_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13685|Zc3h15_chr2_83603792_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm13685|Zc3h15_chr2_83603792_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gap|Gm21950_chrX_3050989_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gap|Gm21950_chrX_3050989_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_E2f6|Rock2_chr12_16866416_F TCGTCGGCAGCGTCCCCGAGTTCTACTGTTCGGG 59.8 0.00
mm4_intergenic_E2f6|Rock2_chr12_16866416_R GTCTCGTGGGCTCGGTGTCCTCCTCGGTGCTCTAA 59.9 0.00
mm4_intergenic_Asic2|4930527B05Rik_chr11_81258655_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Asic2|4930527B05Rik_chr11_81258655_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_A930031H19Rik|Gm25261_chr4_131017325_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_A930031H19Rik|Gm25261_chr4_131017325_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Slc27a2/Gm26697_chr2_126552640_F Primer3: not found at this Tm N.d. 0.00
mm4_exon_Slc27a2/Gm26697_chr2_126552640_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Ctdp1_chr18_80449674_F TCGTCGGCAGCGTCCTGGGATTCCGTTTCAGCCT 60.0 0.00
mm4_exon_Ctdp1_chr18_80449674_R GTCTCGTGGGCTCGGAAGGGTCAGACCTGGACACT 60.1 0.00

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52314144 GTCGATGGACTAGCAGGCAGTGCTGCAGGGCTGGGCGCCGAGCCACGGTCTGCTGGAGCGGCCATGCTTGGCCCGGGACC
CCCAGTCCCCTCCGCGGACAGCCTCTCTGGCCAAGGGCAACCTAGTAGCTCAGACACCGA
mm3_intron_Adcy2_chr13_68733470 TGATTCACTCTGTGGGCTGGGCTGACTGCTTGCTTCTGATGCTTGGTTAATGTTATTTAACTGTATCATGAGCTGTTATC
TAAAACGGATAGCCTCTCTGACCATGGACAGCTAGGCTCCATCTGCTG
mm2_intron_Dagla_chr19_10280444 GCTCTGTTCCTGTCCATGGTTCCCACCAACTGCCCCTGGCCAGAGAGTCTGTCCTCTCCTGGCCCCCTTGCTTCATGTGC
TGCTTCTGCTGTTGTC
mm4_intron_Mgll_chr6_88756795 GTGTGGCTGGCAGGATACCGTCCATTAGCACCGTGGTCAGGGTGGCTGTCCACTGTCTTCCTTGATGACCTTTATCGACC
TCCCTGCCTTGGACTCTGCTCAGTCCTCTGTTTCAGTGTCCGGGGATGATCGAGAATGCA
mm4_intergenic_Adck3|Psen2_chr1_180216477 AGGGCATCAATTCCTCAGCCAATAATAAACCTGAAGAGGAGGGACCCTGGCCAGGGAGGCTGCCCAGACCTCTGAGGAGC
AGAGCTCACCTAGATGGGGGGGGGAGGGGGGAAGAAGCATCATGCCCCT
mm3_intergenic_Uri1|Ccne1_chr7_38074854 TCATCAAAGGCTCCATCGGGCTGCACGCGCCCCGGCCCTGTCCTCCTGGCCGCCGCCTTTGTACTCACTCCTCGGCCAGA
GAGGCTGGCCAC
CTCCCTCTGACTGTGCGCTCCAAACGCAGGGACCCCTCCAAGCTCTAT
mm4_intergenic_Gm13888|AI314831_chr2_105050801 CCACAAGTCCAGCCCATGATAAGCCTTCTTTCACAGGGAAACCCCTGGCCAGTGTGGCTGTCTGGGATTTGTACACCTAG
CACAGTCAATCTTCATTTCAGAAGCCAGAAGCCCC
mm4_intron_Ephb2_chr4_136760881 GCACAATAGAGTGGGGTGCTCCATGCTGGACACCATAGAGATGCCAAGATGCTAGGAACACCCAGGCCAGGGAGGCTGCC
TGC
TGTGTTTGAGTCCCAGCTCTGACCTCACGAAG
mm4_intron_Loxhd1_chr18_77365909 AGATGGCTAACGGACAGGGAATAATGTTCCTTGGGTCCAAGAGTAAAAGAAGGATTAGGTGCAGAACCACCAAGTCCAGA
GAGGTTGTCTGC
AAACTCTCTTACCCTGTAGGATGGGGATGAGAAGGAAGCG
mm4_intron_Mpp2_chr11_102087005 CCAGTGTCCCCTCTGTCAACTCCATGTCCTTATTCCTAGAGAGCAGGGGACAGCTTCTCAGGCCTTGGGCCATACTCCCC
ACTAGAGGTGCTTGCTGTGGTTCCTCTT
mm4_intergenic_Gm23677|Maf_chr8_115674402 TGCATTCCCGGTGAGTACACTCTGTTGACCAGGTAGCAGACCTTCCCATGTCCAAGGAGGCTGTCCTCAGAAACAGAGTG
CTCTACCCACCAGTCGATG
mm4_intron_Ttll7_chr3_146854909 CCAGAGACGTCTTCAGCACAGAAGTGAATTAAGTGACGATCTGAAACTTCGACTGATTTCCATAGCTAGAGAAGCTGTCA
GC
TGAGATGTGCTAGGCTTTAGTCTGTGAAGCACTTTGAATGTCAGGCATGAGGTCTGTT
mm3_intron_Plekhg5_chr4_152078548 AGCTTATGTGCTGGAACGGTGTGGACAGCTTCTCTGGCCCAGGAAGGAATTCTAGATGTGTCATCCCACCTCCGTGACTG
AACCTGAGGGGCGTGGAGGGTGGCAGGGTGTTGGTTAGA
mm3_intron_Ccdc85a_chr11_28423556 AACCAGCCACTTCAACCACATGAGCAGAAAGCTTCTCTGGCCAGAGTTTTAGAAGTCAGTTTTCTATGCAGACT
mm4_intron_Usp24_chr4_106408328 GTGAACTGATGGCCCTGGAGGCCGTCTGGGAACGGAGAGACTCTCTGGCAAAGGGCCCAAAGGACTAGACTACTATTTGT
TTTGATGCTTAGACGCTAAGATTTCTGCCTTTCTCAGTAAACAACAGACTTGCCCAGAGT
mm3_intron_Galnt7_chr8_57532936 GACTGAGAGGCACAGAGAGGCGAGCTCTGTAAGTACACTGGGGGCAGACAGCCGCTCTGGACACGGAACAGACCCTGCTT
TCTCAGTCCTCTCACTGGCTGGGCAGCACTTCTTGGGGAGGGGACTCAA
mm3_intron_Supt3_chr17_45003568 AGCTGCCTTCAGATTGCTGTTGGCAGCCTGCGGTTAGCCTCTCTGGCTAAGGTGCTGTCCAGGGAAGCTATGTGC
mm4_exon_Slc12a9_chr5_137314699 GGGGACACTGAGGTAGCCTAGAGTCACAGAAGAGGCCAGCCCCTCTGGTCAAGGCACCAGTGAAGGAAGCGGAGGAAGAC
C
mm4_exon_Dnah11_chr12_118036441 CAGATCCTGCGGGTTCACATACAAAATGCCAGCTCTGGAGACCGTGGCTGGTGTGGCTGTCCGCAGGTGATGGGTCTCGA
ATAGAAGCCTCATGGAAGGTTTGAGGGCC
mm4_intron_Cdhr2_chr13_54711438 GGCACTACACTGTAGAGGCCAGGGTGCCTTCCTCACGGGGAATCCAGGGCCAGAGGGGTTGTCCACAGACTCTGGGCTGC
ACAGATCGCCCTGCTGAGTCTCTA
mm3_intergenic_Gm24734|Nog_chr11_89264317 CTGCCACCCTACTTGAGCAGGGAACTCTGAGAAGCCATGGCCAGAGTGGCTGACAGCACAATGTGCCATTTAGTGTTGTG
GAGTTTGAGGATTTGCTATCTAGGGAGATGGGCATTCCAGGAG
mm2_intergenic_Kcna5|Kcna1_chr6_126558032 CCACACCATCTGCTCCCATTGATTCTCAGTGCACCTTTCTCAGTCTCAGAGTTGGCCAAGGCTGTGCCTTTCAGCTCCTG
AGGACAGCCTCTCTGGTCACAG
CATAGATGGTCAGGGTCCAACC
mm4_intron_Ascc2_chr11_4644095 TCAGGACCCTACTGAGCCTTTGTTTTCTCCTCGGCCAGACAGGCTGTCACCCTTTTAACTAATCATAGATGAGGGAAAGC
AGTGGGGAGTTT
mm3_intergenic_Gm12158|Ebf1_chr11_44820249 AAGCACTGAGTAGGCTCTGCCACCCTGGCCAGAGAGGCACTCAGCAGTGGCAATTTAAATGGAATGATAATTGTTTTGTT
TTGTTTTTTTTTAAATTTTGCTGACAATTTTTCCTTTAGCCATTCTAGGATGT
mm4_intron_Acan_chr7_79109073 ACACCTCTGCTTCTGCCATCTGTGGGCCAGGAGCCCTAGACAGGACCAGGCTGACACCCGGCACTCCACTTGTGGTGCTT
TCTAAACTCCTGCCAGCCTCTCTGGCCTTGGGCATTCCCAATGCAGAAAAGGAGGCCCA
mm3_intergenic_Taco1|Map3k3_chr11_106084206 AACTGAGCAGAGGGTTGTGGGCGGAGCCTCAAGCCGGAGCAGTGATTGGAGCAGCCCACACCTTGGCCAGAGAGGCTGAG
AGC
GCCAGCTAGCGACACTCCGCGGCGGGTACTCAGCGCTCTCTCCGTGATTGGCTAGGC
mm4_intergenic_2310007B03Rik|E030010N08Rik_chr1_93212286 TGAGCCTTGCCTTAAAGCCACCTACTTCAGCAGCAGAGCACCCTGGCCTGAGAGGCTCTGAGCCTGCTGGAGAATTTGGA
GGGC
mm3_exon_Prtn3_chr10_79881939 GGAAGAGACGAGTCCTCACGTCCTTTTTTCCTATAGCTAAACCGGACAGCCTCCCTGGGCAAGGAGGTGGCGGTGGCTTC
TCTGCCCCAGCAGGACCAGACTCTGTC
mm3_intron_Stk30_chr12_110827736 TGAACATGGATGGAAAATGCCATCAAACCTCATCAGCTATGGCCAGAGAGGCTGTGCTGTCACGAGAAAGTAACTCACAT
AATTCGCAATTCATGGAGACCTGACTGAGCTGCAG
mm3_intergenic_Lingo1|Odf3l1_chr9_56792589 CTTCCCCACAGCATCAGGACCATCTCACAGCCTCTCTGGCCAAAGGTCCCCAGCATCAGCATCAGGCATGGTTTAAATCA
CAAATCTAATTTTGTCCCTTGAGAATTTCATCCCTGACCCCTGC
mm4_exon_Gsr_chr8_33681507 CTTCGCTTTCCTTTCAGCCGCAGCGTCATCGTGGGGGCCGGGTACATTGCTGTGGAGATCGCGGGCATCCTCTCTGCCCT
GGG
CTCCAAGACATCTCTTATGATCAGGCATGATAAGGTAAGTCCTGTCTCCTCCTGTCC
mm3_intron_Sept9_chr11_117313412 TTCCTGGCTGCTTCACTCTGCTGCCAGCTTCAGGGCCGTGGCCTCAGAGGGCCCTTCCTCTCTTCAGCCAACACAGCTGG
AGTCCCTGCCCTGGGAGGCTGTCCGCAAGCAGTGTTGAGGACCTGG
mm4_intergenic_Otud7a|Gm5898_chr7_63448867 CGCTGGCTGGCTTGTACATAACATATCTGAACTAAAGCAGAATTGTGGAGCCAAGGATGGGGACCGTATGGACCATGCAG
CATCTCTCAGCCAGCCTCTCTGGGCAAGGCACACCTTGATCATGCCCCAG
mm3_intergenic_Ntf3|Kcna5_chr6_126483380 GCTGTCCACCTCCGATTACTTCATCACAGGCGCTGACAGCCCCTCTGGGCAGGGCTCCTGGCACCACCCCACGAGGGGAG
CATCTGCGATCGTTACCCATCCTCATCAAATTCAGATTTATGGAGTGTGAGGCTTGACAA
mm4_intergenic_1700019O17Rik|Ptma_chr1_86506152 CTTGAGTGGGCAAAATGGCTATCCTTGGACAGAGAGGCTGGACACTCCTAGGGGAGAGCCCAGGAAGGGTCTTCTGTCAG
AGCCTCCTCTGGAGCAAAGGGGGCAGAACTGGAGTTAGGGAGGCCAGGAGA
mm3_intron_Stx18_chr5_38063524 TAGCGTTTATCTGGGGCAGGAGAGTTAGCACTCAGCTGAGGCCAGAGAGGCTGTGAGCTGCAGCTGCTTAGTTCTAAACT
AGGCGTTGATGGAGTGTAAAGATCCGCATTCTGTGACTTTGGA
mm4_intergenic_Hspb1|Ywhag_chr5_135896247 TCCAAACAAGGAGAGTGGGCTTCAGCCCCAGACCTCAGTGAGGTCGGTGGATTCCATGCCCAGAGGCTCTGTCCGCTATC
AGAGAAGGAAAGGTTGTGCTGGGGAGA
mm2_intron_Plekhd1_chr12_80715702 TGGGCCTTTCAACAGCTCTTACTGACAAACTGATAGCAGACAAACACTGCCAGAGGAGATCCTCTCAAGTTTGTTGACTC
TGGGGCCAGAGAGGCTGTCAGC
ACCATGCGTATTAAAGCAGAGC
mm2_exon_Dedd2_chr7_25203638 CCCTCCTTCCTCCTCCATCAGCAACAGGCGACGCCGGCCAGCCTCATAGTCAGCCTCGTCCACACTGACCAGCAAGCGGA
CAGCCTCTCGGCCCACGG
CCTCCCGTAAAGCCTCAGTCAGGAACACG
mm4_intergenic_Scube2|Dennd5a_chr7_109865781 TCATTTTCACACGGTCTTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
GCCCGAGCCGCTGTCAGC
AGAGCCCTGCGCTCGCTCTCCCGCTCGCTCGCGGAGTCTTG
mm4_intergenic_Gm8623|Ing2_chr8_47659691 TGGAGGTCTGAAGAGAGGCAGGAGTACCACCGTGGCCACAGACACTGGCCGCTGTACTGTCAACACCATGGAAGAGGGTG
GTGGCAGTGGAAAGGCAGTGTAAGGCAAGCAAGTAAAGGCCAAGAGCGATGGG
mm4_intergenic_Gm26601|Dip2c_chr13_9484760 GCAGGATGTCTCATGGCCTTGTTGAAAGCCTCTCTTGCCAGGGCTAGGGCAATGGTCAAGTGGAT
mm4_intergenic_E2f6|Rock2_chr12_16866416 CCCGAGTTCTACTGTTCGGGAGAAAGCCAGCCTGGACCCCACCTCTCCTAGGCCACAGAGGCTCTCCCCCATTAGAGCAC
CGAGGAGGACA
mm4_exon_Ctdp1_chr18_80449674 CTGGGATTCCGTTTCAGCCTCTTTCCGGTCCACACTGCCATTGCCCAGGCCACAGAGGCTGTCCCGTTCACCCTCCTCCT
GAGTGTCCAGGTCTGACCCTT

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.

After sequencing, run CRISPRessoPooled. The tool will map the reads to the amplicons and analyse the mutations:
CRISPRessoPooled -r1 Reads1.fastq.gz -r2 Reads2.fastq.gz -f crisporAmplicons_mN1FkRligAThyqKv3eg3.txt --name MY_EXPERIMENT

Version 5.01 - Documentation  - Contact us - Downloads/local installation - Citation - License
CRISPR/Cas9 Guide Designer for chordate vertebrate ecdysozoans lophotrochozoans protostomes spongi corals plants butterflies metazoans genomes fruitflies insects nematodes mammals.