← return to the list of all guides

Contents:

PCR primers for off-targets of ATCCACTTGCGTTCGCCGAG TGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Maximum amplicon length:     Primer Tm:

NamePrimer Sequence Tm CFD Score
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313533_F Primer3: not found at this Tm N.d. 1.00
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313533_R Primer3: not found at this Tm N.d. 1.00
mm4_intergenic_Nell2|Gm24668_chr15_95542211_F Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Nell2|Gm24668_chr15_95542211_R Primer3: not found at this Tm N.d. 0.19
mm4_intron_Itsn1_chr16_91826264_F Primer3: not found at this Tm N.d. 0.16
mm4_intron_Itsn1_chr16_91826264_R Primer3: not found at this Tm N.d. 0.16
mm4_intron_Galnt2_chr8_124280514_F TCGTCGGCAGCGTCGAGATGGTTTGCATGCCAGT 58.8 0.10
mm4_intron_Galnt2_chr8_124280514_R GTCTCGTGGGCTCGGGTTCAGGAATCGACTGCCCA 60.0 0.10
mm4_intergenic_Cant1|C1qtnf1_chr11_118420310_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Cant1|C1qtnf1_chr11_118420310_R Primer3: not found at this Tm N.d. 0.09
mm4_exon_Ccdc80_chr16_45094853_F TCGTCGGCAGCGTCCCCAGCTCTGCTTGCAATTA 58.5 0.06
mm4_exon_Ccdc80_chr16_45094853_R GTCTCGTGGGCTCGGTGGGGTCCCATTTTCCACAT 59.2 0.06
mm3_intron_Skint9_chr4_112396168_F Primer3: not found at this Tm N.d. 0.02
mm3_intron_Skint9_chr4_112396168_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Oaf_chr9_43226858_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Oaf_chr9_43226858_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Gm16239_chr10_99181635_F TCGTCGGCAGCGTCGACCAGAGTGTGCATGGTCA 59.9 0.00
mm4_exon_Gm16239_chr10_99181635_R GTCTCGTGGGCTCGGGCTTCTCTTTCCGGCCTCAT 60.1 0.00

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

mm4_intron_Galnt2_chr8_124280514 GAGATGGTTTGCATGCCAGTATAGTTGGACCCTCTTGCGTTTGCTGAGGGGAGGTGGTTGAGACGTTGTAACTGGGAAAA
GCGTATATGATGGGCAGTCGATTCCTGAAC
mm4_exon_Ccdc80_chr16_45094853 CCCAGCTCTGCTTGCAATTAATGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATT
ATACCCCCTCTGCGTCCCCAAGTGGATAATACAATGATGTGGAAAATGGGACCCCA
mm4_exon_Gm16239_chr10_99181635 GACCAGAGTGTGCATGGTCAGCAGCTGCAAAGGCAAGGAGGCTTCAGAAGGAAATGGGTTCAGAGAACTGAGCAACACCA
CTCGGCCACCGCATTTGGATTGAGCTGAGGACCGTAGATGAGGCCGGAAAGAGAAGC

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.

After sequencing, run CRISPRessoPooled. The tool will map the reads to the amplicons and analyse the mutations:
CRISPRessoPooled -r1 Reads1.fastq.gz -r2 Reads2.fastq.gz -f crisporAmplicons_mN1FkRligAThyqKv3eg3.txt --name MY_EXPERIMENT

Version 5.01 - Documentation  - Contact us - Downloads/local installation - Citation - License
CRISPR/Cas9 Guide Designer for chordate vertebrate ecdysozoans lophotrochozoans protostomes spongi corals plants butterflies metazoans genomes fruitflies insects nematodes mammals.