← return to the list of all guides

Contents:

PCR primers for off-targets of TGGGGCACCATCTTCTCTGG CGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Maximum amplicon length:     Primer Tm:

NamePrimer Sequence Tm CFD Score
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313955_F Primer3: not found at this Tm N.d. 1.00
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313955_R Primer3: not found at this Tm N.d. 1.00
mm3_intergenic_Gm6189|Dock10_chr1_80385195_F TCGTCGGCAGCGTCTTGTAGTGCAGACGGCCTTT 59.8 0.80
mm3_intergenic_Gm6189|Dock10_chr1_80385195_R GTCTCGTGGGCTCGGCCTCTTTCTCTCGTGTCTTAGTCC 60.1 0.80
mm2_intergenic_Fam170a|Hdhd1a_chr18_50350849_F Primer3: not found at this Tm N.d. 0.66
mm2_intergenic_Fam170a|Hdhd1a_chr18_50350849_R Primer3: not found at this Tm N.d. 0.66
mm4_intron_Mpped1_chr15_83851103_F TCGTCGGCAGCGTCCCATTCTGTGGCTGGGTCTT 59.9 0.63
mm4_intron_Mpped1_chr15_83851103_R GTCTCGTGGGCTCGGCTGCTTCCTCTGCCCACTG 60.3 0.63
mm3_intergenic_D5Ertd579e|Bloc1s4_chr5_36731959_F Primer3: not found at this Tm N.d. 0.61
mm3_intergenic_D5Ertd579e|Bloc1s4_chr5_36731959_R Primer3: not found at this Tm N.d. 0.61
mm4_intergenic_Gm23476|Gm26159_chr16_8250106_F Primer3: not found at this Tm N.d. 0.46
mm4_intergenic_Gm23476|Gm26159_chr16_8250106_R Primer3: not found at this Tm N.d. 0.46
mm4_intergenic_Gm11890|Gm11892_chr4_24225365_F Primer3: not found at this Tm N.d. 0.44
mm4_intergenic_Gm11890|Gm11892_chr4_24225365_R Primer3: not found at this Tm N.d. 0.44
mm4_intron_Ldlrad4_chr18_68136449_F Primer3: not found at this Tm N.d. 0.41
mm4_intron_Ldlrad4_chr18_68136449_R Primer3: not found at this Tm N.d. 0.41
mm4_intergenic_Gm11260|Gm11261_chr4_78381439_F TCGTCGGCAGCGTCGGTACTCTAACCCTGAGAGTGG 58.9 0.39
mm4_intergenic_Gm11260|Gm11261_chr4_78381439_R GTCTCGTGGGCTCGGTACTCAGTGAGTGCCACCCT 60.1 0.39
mm4_intergenic_Gm25923|Gm25564_chr12_28231114_F Primer3: not found at this Tm N.d. 0.38
mm4_intergenic_Gm25923|Gm25564_chr12_28231114_R Primer3: not found at this Tm N.d. 0.38
mm4_intergenic_Satb2|Gm23943_chr1_56997480_F TCGTCGGCAGCGTCGCATGGGATGGGTGCTAGAG 60.2 0.38
mm4_intergenic_Satb2|Gm23943_chr1_56997480_R GTCTCGTGGGCTCGGAGCTGGACAATATACCACGCT 59.2 0.38
mm4_intergenic_Gm15443|Gm23535_chr1_149344327_F TCGTCGGCAGCGTCACTCAATGGAATCTCTAGGACAGT 58.7 0.37
mm4_intergenic_Gm15443|Gm23535_chr1_149344327_R GTCTCGTGGGCTCGGGGCATGGGGCTGATCTCATA 59.3 0.37
mm4_intergenic_B430305J03Rik/Rap2b|Gm8349_chr3_61371863_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_B430305J03Rik/Rap2b|Gm8349_chr3_61371863_R Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm6803|Gm2056_chr12_88025193_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm6803|Gm2056_chr12_88025193_R Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm5039|Gm10264_chr12_88327435_F TCGTCGGCAGCGTCTCGTCTTTCTTACTTGTGTCTTAGT 57.9 0.35
mm4_intergenic_Gm5039|Gm10264_chr12_88327435_R GTCTCGTGGGCTCGGCAGGACTGGAACCAACAACCT 60.1 0.35
mm4_intergenic_Gm2056|Gm16368_chr12_88081883_F Primer3: not found at this Tm N.d. 0.35
mm4_intergenic_Gm2056|Gm16368_chr12_88081883_R Primer3: not found at this Tm N.d. 0.35
mm4_exon_Gm21319_chr12_87775569_F Primer3: not found at this Tm N.d. 0.35
mm4_exon_Gm21319_chr12_87775569_R Primer3: not found at this Tm N.d. 0.35
mm2_intergenic_Gm24720|Tshz1_chr18_83953526_F Primer3: not found at this Tm N.d. 0.31
mm2_intergenic_Gm24720|Tshz1_chr18_83953526_R Primer3: not found at this Tm N.d. 0.31
mm4_intergenic_Gm26828|Gm9835_chr6_4882696_F Primer3: not found at this Tm N.d. 0.29
mm4_intergenic_Gm26828|Gm9835_chr6_4882696_R Primer3: not found at this Tm N.d. 0.29
mm4_intron_Fbxw11_chr11_32671333_F Primer3: not found at this Tm N.d. 0.28
mm4_intron_Fbxw11_chr11_32671333_R Primer3: not found at this Tm N.d. 0.28
mm4_intron_Pde8b_chr13_95159698_F TCGTCGGCAGCGTCAAAATGGCCCACACCAGGAA 60.1 0.28
mm4_intron_Pde8b_chr13_95159698_R GTCTCGTGGGCTCGGCATCATCTCTTGGGGTGGGG 59.8 0.28
mm4_intergenic_Gm23112|Gm8955_chr3_14280667_F Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_Gm23112|Gm8955_chr3_14280667_R Primer3: not found at this Tm N.d. 0.28
mm4_intergenic_1700029M20Rik|Ifnlr1_chr4_135634137_F Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_1700029M20Rik|Ifnlr1_chr4_135634137_R Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Fbf1|Acox1_chr11_116170714_F Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Fbf1|Acox1_chr11_116170714_R Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Foxi2|Clrn3_chr7_135427002_F Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Foxi2|Clrn3_chr7_135427002_R Primer3: not found at this Tm N.d. 0.27
mm4_intergenic_Gm2574|Gm24728_chr3_143078895_F Primer3: not found at this Tm N.d. 0.26
mm4_intergenic_Gm2574|Gm24728_chr3_143078895_R Primer3: not found at this Tm N.d. 0.26
mm4_exon_Srpk1_chr17_28603497_F TCGTCGGCAGCGTCCGGAAGCCCCTGATAGTTGG 60.1 0.25
mm4_exon_Srpk1_chr17_28603497_R GTCTCGTGGGCTCGGCTACCTGCTTCCTTGGGCC 60.0 0.25
mm3_intergenic_Tmem45b|Barx2_chr9_31730676_F TCGTCGGCAGCGTCGACACAGCTGTTTCCCAGGA 59.8 0.25
mm3_intergenic_Tmem45b|Barx2_chr9_31730676_R GTCTCGTGGGCTCGGGGCTCTCCCACTTCTTAGGC 59.8 0.25
mm4_intergenic_5031434O11Rik|Mgst2_chr3_51591700_F Primer3: not found at this Tm N.d. 0.25
mm4_intergenic_5031434O11Rik|Mgst2_chr3_51591700_R Primer3: not found at this Tm N.d. 0.25
mm4_intergenic_D030018L15Rik|2610037D02Rik_chr15_96090558_F TCGTCGGCAGCGTCTCAGGAGCTGAAGGAGAGAGA 59.3 0.24
mm4_intergenic_D030018L15Rik|2610037D02Rik_chr15_96090558_R GTCTCGTGGGCTCGGGCTGAGTGTACAGTGTCCTCC 60.0 0.24
mm4_intergenic_Gm13255|Gm13217_chr2_8720037_F Primer3: not found at this Tm N.d. 0.23
mm4_intergenic_Gm13255|Gm13217_chr2_8720037_R Primer3: not found at this Tm N.d. 0.23
mm4_intergenic_Gm23117|Gm5083_chr13_44077572_F TCGTCGGCAGCGTCGACTCAGGCAAGTGGAGGTG 60.3 0.23
mm4_intergenic_Gm23117|Gm5083_chr13_44077572_R GTCTCGTGGGCTCGGTCCTCTTCATTTTAACTGCTGGGA 59.9 0.23
mm4_intergenic_Gm12010|Gm12011_chr11_16194411_F Primer3: not found at this Tm N.d. 0.22
mm4_intergenic_Gm12010|Gm12011_chr11_16194411_R Primer3: not found at this Tm N.d. 0.22
mm4_intergenic_Mettl18|Sele_chr1_164023491_F TCGTCGGCAGCGTCTGCAATTTATTGTTCCCTTTCTTGT 58.1 0.22
mm4_intergenic_Mettl18|Sele_chr1_164023491_R GTCTCGTGGGCTCGGTGGCATGAAGGGGAAACAGA 59.2 0.22
mm4_intergenic_Gm13857|Bpgm_chr6_34448721_F TCGTCGGCAGCGTCTGCAATTTCTTGTTTTCTTCCTTGT 58.5 0.22
mm4_intergenic_Gm13857|Bpgm_chr6_34448721_R GTCTCGTGGGCTCGGGGCATGAAGAAGAAACAGATGGG 59.8 0.22
mm4_intron_Gm9994_chr1_93936704_F Primer3: not found at this Tm N.d. 0.22
mm4_intron_Gm9994_chr1_93936704_R Primer3: not found at this Tm N.d. 0.22
mm4_intron_Gm6086_chr1_94004964_F TCGTCGGCAGCGTCTGTTCTTATGTCACCTGGTGCA 59.8 0.22
mm4_intron_Gm6086_chr1_94004964_R GTCTCGTGGGCTCGGTACTGGGAAGGGTGGGAACT 59.8 0.22
mm4_intron_Gal3st2_chr1_93870536_F Primer3: not found at this Tm N.d. 0.22
mm4_intron_Gal3st2_chr1_93870536_R Primer3: not found at this Tm N.d. 0.22
mm4_intergenic_Gm11546|AA623943_chr11_94804402_F TCGTCGGCAGCGTCTGAGGTGTGTGTTCCAACCC 60.1 0.21
mm4_intergenic_Gm11546|AA623943_chr11_94804402_R GTCTCGTGGGCTCGGGAGCTGGGCATGTGTCTTCT 60.0 0.21
mm4_intergenic_AA623943|Gm11543_chr11_94819994_F TCGTCGGCAGCGTCTGAGGTGTGTGTTCCAACCC 60.1 0.21
mm4_intergenic_AA623943|Gm11543_chr11_94819994_R GTCTCGTGGGCTCGGGAGCTGGGCATGTGTCTTCT 60.0 0.21
mm4_exon_Aoc3_chr11_101331311_F Primer3: not found at this Tm N.d. 0.20
mm4_exon_Aoc3_chr11_101331311_R Primer3: not found at this Tm N.d. 0.20
mm3_intron_2610316D01Rik_chr3_45326820_F Primer3: not found at this Tm N.d. 0.20
mm3_intron_2610316D01Rik_chr3_45326820_R Primer3: not found at this Tm N.d. 0.20
mm4_intron_Lyn_chr4_3779601_F TCGTCGGCAGCGTCCACACTTCCTGCCAGCACTA 59.9 0.19
mm4_intron_Lyn_chr4_3779601_R GTCTCGTGGGCTCGGCTGACAACAAAGCAAGGGCA 59.2 0.19
mm4_intron_Adck1_chr12_88434894_F Primer3: not found at this Tm N.d. 0.19
mm4_intron_Adck1_chr12_88434894_R Primer3: not found at this Tm N.d. 0.19
mm3_intergenic_Gap43|4932412D23Rik_chr16_42449499_F Primer3: not found at this Tm N.d. 0.19
mm3_intergenic_Gap43|4932412D23Rik_chr16_42449499_R Primer3: not found at this Tm N.d. 0.19
mm4_intron_Lin7a_chr10_107377419_F Primer3: not found at this Tm N.d. 0.19
mm4_intron_Lin7a_chr10_107377419_R Primer3: not found at this Tm N.d. 0.19
mm4_intergenic_Olfr1312|Olfr1313_chr2_112069521_F Primer3: not found at this Tm N.d. 0.18
mm4_intergenic_Olfr1312|Olfr1313_chr2_112069521_R Primer3: not found at this Tm N.d. 0.18
mm4_intergenic_Gm14014|BB218582_chr2_106625458_F Primer3: not found at this Tm N.d. 0.18
mm4_intergenic_Gm14014|BB218582_chr2_106625458_R Primer3: not found at this Tm N.d. 0.18
mm4_intron_Lcmt1_chr7_123401354_F Primer3: not found at this Tm N.d. 0.18
mm4_intron_Lcmt1_chr7_123401354_R Primer3: not found at this Tm N.d. 0.18
mm4_intergenic_Trim29|Pvrl1_chr9_43667943_F TCGTCGGCAGCGTCAATGGCAAGTGGAAGGCGTA 59.9 0.17
mm4_intergenic_Trim29|Pvrl1_chr9_43667943_R GTCTCGTGGGCTCGGTCAGGCAGTCTCATTGACCC 59.3 0.17
mm4_exon_Ctdsp1_chr1_74396068_F TCGTCGGCAGCGTCGCTGACCTGAGAGGAACCAA 59.3 0.17
mm4_exon_Ctdsp1_chr1_74396068_R GTCTCGTGGGCTCGGTCTCCTGCCCACGTACAAAC 59.9 0.17
mm4_intron_Casz1_chr4_148932197_F TCGTCGGCAGCGTCGGAGGTTGGCAAGAGGTGAG 60.3 0.17
mm4_intron_Casz1_chr4_148932197_R GTCTCGTGGGCTCGGGAGGAAGCCACTGTGAGTCC 60.0 0.17
mm4_intergenic_Gm22207|Gm5607_chr8_12385355_F TCGTCGGCAGCGTCCAAGAGGTAGGGAAAGCCGG 60.1 0.16
mm4_intergenic_Gm22207|Gm5607_chr8_12385355_R GTCTCGTGGGCTCGGTTCGGGACCCTTGGACCATA 60.2 0.16
mm4_intergenic_9230104M06Rik/Brf1|Pacs2_chr12_113002304_F TCGTCGGCAGCGTCCAGCAAGTTCTTCAGCCCCT 60.2 0.16
mm4_intergenic_9230104M06Rik/Brf1|Pacs2_chr12_113002304_R GTCTCGTGGGCTCGGAGAATGGCAGGGAAGCATCC 60.1 0.16
mm4_intron_Api5_chr2_94428643_F Primer3: not found at this Tm N.d. 0.15
mm4_intron_Api5_chr2_94428643_R Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Dleu2|Gm26969_chr14_61729578_F Primer3: not found at this Tm N.d. 0.15
mm4_intergenic_Dleu2|Gm26969_chr14_61729578_R Primer3: not found at this Tm N.d. 0.15
mm4_intron_Zfp618_chr4_63093902_F TCGTCGGCAGCGTCGAGCACTTGGGCAGATCACT 60.0 0.15
mm4_intron_Zfp618_chr4_63093902_R GTCTCGTGGGCTCGGCCATGGTGAAGGCCAGATGT 60.0 0.15
mm4_intergenic_Plch2|Gm10564_chr4_155020907_F Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_Plch2|Gm10564_chr4_155020907_R Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_Gm23749|Gm13912_chr2_108118506_F Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_Gm23749|Gm13912_chr2_108118506_R Primer3: not found at this Tm N.d. 0.14
mm4_intron_Gpr39_chr1_125781159_F Primer3: not found at this Tm N.d. 0.14
mm4_intron_Gpr39_chr1_125781159_R Primer3: not found at this Tm N.d. 0.14
mm3_intergenic_4930578C19Rik|Gm6923_chrX_18850886_F Primer3: not found at this Tm N.d. 0.14
mm3_intergenic_4930578C19Rik|Gm6923_chrX_18850886_R Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_AI606473|Tyw3_chr3_154437666_F Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_AI606473|Tyw3_chr3_154437666_R Primer3: not found at this Tm N.d. 0.14
mm4_intron_Scamp5_chr9_57464406_F TCGTCGGCAGCGTCTCAAGGCCTCCAGCAAAACA 60.1 0.14
mm4_intron_Scamp5_chr9_57464406_R GTCTCGTGGGCTCGGTGGAGAAATGACTTGGGGCC 59.9 0.14
mm4_intron_Slc8a1_chr17_81560217_F TCGTCGGCAGCGTCGCTGGCTTCTTCAAGTTGGC 60.0 0.13
mm4_intron_Slc8a1_chr17_81560217_R GTCTCGTGGGCTCGGTTTCCAGTTGGCCCTAGCTG 59.9 0.13
mm4_intergenic_Gm23750|Olfm3_chr3_114889766_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm23750|Olfm3_chr3_114889766_R Primer3: not found at this Tm N.d. 0.13
mm4_exon_Thbs3_chr3_89223346_F Primer3: not found at this Tm N.d. 0.13
mm4_exon_Thbs3_chr3_89223346_R Primer3: not found at this Tm N.d. 0.13
mm3_exon_Igfn1_chr1_135968829_F TCGTCGGCAGCGTCGCATTGCCAGACACTTGAGC 60.1 0.12
mm3_exon_Igfn1_chr1_135968829_R GTCTCGTGGGCTCGGTTTCTTGGTGCCAGGACCTC 59.8 0.12
mm4_intron_Arhgdib_chr6_136935663_F TCGTCGGCAGCGTCTGATGCAGCTGGTGGATGTT 59.9 0.12
mm4_intron_Arhgdib_chr6_136935663_R GTCTCGTGGGCTCGGTCTCCACTCTGGCTATCCGT 59.7 0.12
mm3_intron_Cct5_chr15_31599605_F Primer3: not found at this Tm N.d. 0.12
mm3_intron_Cct5_chr15_31599605_R Primer3: not found at this Tm N.d. 0.12
mm4_intergenic_Purb/Gm22123/Gm11973|Gm11973_chr11_6481718_F TCGTCGGCAGCGTCAAGAGACAGGTGTGGGAGGT 60.1 0.12
mm4_intergenic_Purb/Gm22123/Gm11973|Gm11973_chr11_6481718_R GTCTCGTGGGCTCGGACGTGGAGGCTCTGTAGAGT 59.9 0.12
mm4_intron_Dennd1a_chr2_38030070_F TCGTCGGCAGCGTCAAGGAGCTGGTGTGGTGATG 59.9 0.12
mm4_intron_Dennd1a_chr2_38030070_R GTCTCGTGGGCTCGGCCTGCTCACAACTCTCCCAG 60.0 0.12
mm4_intron_Hkdc1_chr10_62394386_F Primer3: not found at this Tm N.d. 0.12
mm4_intron_Hkdc1_chr10_62394386_R Primer3: not found at this Tm N.d. 0.12
mm4_exon_Zcchc5_chrX_106839316_F TCGTCGGCAGCGTCCCCCTGAACTCTGTGATGGC 60.3 0.11
mm4_exon_Zcchc5_chrX_106839316_R GTCTCGTGGGCTCGGCCTCAGCCATCAGTGAGCTC 60.1 0.11
mm4_intron_Pde8b_chr13_95159900_F Primer3: not found at this Tm N.d. 0.11
mm4_intron_Pde8b_chr13_95159900_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Olfr583|Olfr584_chr7_103057832_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Olfr583|Olfr584_chr7_103057832_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Slco5a1|Gm5250_chr1_12994738_F TCGTCGGCAGCGTCACTTCTGATCTCGGCTCCCT 60.0 0.11
mm4_intergenic_Slco5a1|Gm5250_chr1_12994738_R GTCTCGTGGGCTCGGCCAGAAGGGTCTAACAAACAGC 59.1 0.11
mm4_exon_Wbp1_chr6_83120848_F TCGTCGGCAGCGTCGGTTCCAGCTCGTCTCCAAA 59.9 0.11
mm4_exon_Wbp1_chr6_83120848_R GTCTCGTGGGCTCGGTTCCCTCTGTCTTGCAGCAG 59.9 0.11
mm4_intergenic_Mir5099|Meox2_chr12_37099606_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Mir5099|Meox2_chr12_37099606_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Snap91|Ripply2_chr9_86955919_F Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Snap91|Ripply2_chr9_86955919_R Primer3: not found at this Tm N.d. 0.11
mm4_intergenic_Scamp1|Gm9776_chr13_94319947_F Primer3: not found at this Tm N.d. 0.10
mm4_intergenic_Scamp1|Gm9776_chr13_94319947_R Primer3: not found at this Tm N.d. 0.10
mm4_intergenic_Slc30a4|Slc30a4/4930417H01Rik_chr2_122697984_F Primer3: not found at this Tm N.d. 0.10
mm4_intergenic_Slc30a4|Slc30a4/4930417H01Rik_chr2_122697984_R Primer3: not found at this Tm N.d. 0.10
mm4_intron_Camta1_chr4_151740015_F TCGTCGGCAGCGTCCCCCAAGCTTCCAGTACCTG 60.0 0.10
mm4_intron_Camta1_chr4_151740015_R GTCTCGTGGGCTCGGCCCGTGTGTAGTTTGTGGGA 59.8 0.10
mm4_intron_Auts2_chr5_131777516_F Primer3: not found at this Tm N.d. 0.10
mm4_intron_Auts2_chr5_131777516_R Primer3: not found at this Tm N.d. 0.10
mm4_intron_Pik3cd_chr4_149701735_F Primer3: not found at this Tm N.d. 0.10
mm4_intron_Pik3cd_chr4_149701735_R Primer3: not found at this Tm N.d. 0.10
mm4_intergenic_Gm22704|Gm14234_chr2_168350901_F Primer3: not found at this Tm N.d. 0.10
mm4_intergenic_Gm22704|Gm14234_chr2_168350901_R Primer3: not found at this Tm N.d. 0.10
mm4_intron_Glis1_chr4_107633146_F TCGTCGGCAGCGTCGGAGGCCACCAGTAAACACA 59.8 0.10
mm4_intron_Glis1_chr4_107633146_R GTCTCGTGGGCTCGGGGCAAGGGAGAACACAGACA 59.8 0.10
mm4_intergenic_Gm26565/Celf2|Celf2_chr2_7082538_F TCGTCGGCAGCGTCTTCTTGAGCACAGCCTCCTG 59.9 0.09
mm4_intergenic_Gm26565/Celf2|Celf2_chr2_7082538_R GTCTCGTGGGCTCGGTCTGCCTCAGGATCCTGTGA 59.9 0.09
mm4_intron_Kdm4b_chr17_56384532_F TCGTCGGCAGCGTCTTGCACTGATGGGTGAGTCC 59.9 0.09
mm4_intron_Kdm4b_chr17_56384532_R GTCTCGTGGGCTCGGCGAAGTCACACCCTAAGCCA 59.6 0.09
mm4_intergenic_Pfkl|Aire_chr10_78010762_F TCGTCGGCAGCGTCGATCTGGGCTGCCATGGTAG 60.2 0.09
mm4_intergenic_Pfkl|Aire_chr10_78010762_R GTCTCGTGGGCTCGGTCAACAAACTGTCAGGGTCAGA 59.4 0.09
mm4_intergenic_1700011J10Rik|Ola1_chr2_73047498_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_1700011J10Rik|Ola1_chr2_73047498_R Primer3: not found at this Tm N.d. 0.08
mm4_exon_Fam171b_chr2_83812948_F TCGTCGGCAGCGTCCTCCGACCTCAGCCTCATC 59.2 0.08
mm4_exon_Fam171b_chr2_83812948_R GTCTCGTGGGCTCGGGCTACCGAGACGTACCTGGA 60.7 0.08
mm4_exon_Ptprd_chr4_76091455_F TCGTCGGCAGCGTCGTGGTGGACACTAGCTTGGG 60.3 0.08
mm4_exon_Ptprd_chr4_76091455_R GTCTCGTGGGCTCGGGGACATGATCATCTCTGGGCT 59.3 0.08
mm4_exon_Zfp60_chr7_27751694_F Primer3: not found at this Tm N.d. 0.08
mm4_exon_Zfp60_chr7_27751694_R Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_RP23-131O4.2|Gm23470_chr14_48913477_F Primer3: not found at this Tm N.d. 0.08
mm4_intergenic_RP23-131O4.2|Gm23470_chr14_48913477_R Primer3: not found at this Tm N.d. 0.08
mm3_exon_Ubxn7_chr16_32387017_F Primer3: not found at this Tm N.d. 0.07
mm3_exon_Ubxn7_chr16_32387017_R Primer3: not found at this Tm N.d. 0.07
mm4_intron_Ttll11_chr2_35954625_F TCGTCGGCAGCGTCCCCTGGCCTTCCTTTCCTTT 59.8 0.07
mm4_intron_Ttll11_chr2_35954625_R GTCTCGTGGGCTCGGGCCCTGAGCACATCTACCTT 59.4 0.07
mm3_intron_Sntb1_chr15_55726654_F TCGTCGGCAGCGTCGAGTGCACAAACGCAACTGT 59.9 0.07
mm3_intron_Sntb1_chr15_55726654_R GTCTCGTGGGCTCGGGCAAAGCAAGGTGGACTGTA 58.3 0.07
mm4_intergenic_Tmc1|Zfand5_chr19_20983735_F Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Tmc1|Zfand5_chr19_20983735_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Tcerg1l|Mapk1ip1_chr7_138647697_F TCGTCGGCAGCGTCCCTCCAGGTTAGGGACACAAG 59.7 0.06
mm4_intergenic_Tcerg1l|Mapk1ip1_chr7_138647697_R GTCTCGTGGGCTCGGAGATGTCCTGCCTGCTTGTC 60.0 0.06
mm4_intergenic_Gm23355|Gm21833_chr16_82772668_F TCGTCGGCAGCGTCTTTCTGGCAGCAACCCTGAG 60.5 0.06
mm4_intergenic_Gm23355|Gm21833_chr16_82772668_R GTCTCGTGGGCTCGGCTCTGGAGGCAGGTTAGGTG 59.4 0.06
mm4_intergenic_A930011G23Rik|Gm16227_chr5_99423477_F Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_A930011G23Rik|Gm16227_chr5_99423477_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_B930078G14Rik|Fam155a_chr8_8999662_F Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_B930078G14Rik|Fam155a_chr8_8999662_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Pvrl3|Gm6912_chr16_46601498_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Pvrl3|Gm6912_chr16_46601498_R Primer3: not found at this Tm N.d. 0.05
mm2_intergenic_G630016G05Rik|Gm13991_chr2_116278097_F Primer3: not found at this Tm N.d. 0.05
mm2_intergenic_G630016G05Rik|Gm13991_chr2_116278097_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Nipal2|Kcns2_chr15_34775739_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Nipal2|Kcns2_chr15_34775739_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Slc30a8|Gm10020_chr15_52447523_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Slc30a8|Gm10020_chr15_52447523_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Gm26054|Xylt1_chr7_117201786_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Gm26054|Xylt1_chr7_117201786_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Fbxo15|Gm25453_chr18_85965160_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Fbxo15|Gm25453_chr18_85965160_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Tnfrsf19|Sacs_chr14_61096946_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Tnfrsf19|Sacs_chr14_61096946_R Primer3: not found at this Tm N.d. 0.04
mm4_intron_Cers6_chr2_69098837_F TCGTCGGCAGCGTCGGCCTGTCTCTCTGGAAACC 60.0 0.04
mm4_intron_Cers6_chr2_69098837_R GTCTCGTGGGCTCGGATGCTCAGAGCCAAGCCATT 60.0 0.04
mm4_intergenic_Gm10845|Gm6999_chr14_79872545_F TCGTCGGCAGCGTCGCCTCACCACACCTACTCAC 60.0 0.04
mm4_intergenic_Gm10845|Gm6999_chr14_79872545_R GTCTCGTGGGCTCGGTCTGAGGGTCTCTCTCTGCC 60.0 0.04
mm4_intron_Nelfa_chr5_33900140_F TCGTCGGCAGCGTCACCCAAGCTTATGTCTGCCC 60.0 0.04
mm4_intron_Nelfa_chr5_33900140_R GTCTCGTGGGCTCGGTAGCTGCCAAGATTGCCACT 59.6 0.04
mm4_intron_Map7_chr10_20246954_F Primer3: not found at this Tm N.d. 0.04
mm4_intron_Map7_chr10_20246954_R Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Socs5|Gm22346_chr17_87147203_F Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Socs5|Gm22346_chr17_87147203_R Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Gm9081|Avpr1a_chr10_122330389_F Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Gm9081|Avpr1a_chr10_122330389_R Primer3: not found at this Tm N.d. 0.04
mm4_intron_1700007B14Rik_chr8_75881263_F Primer3: not found at this Tm N.d. 0.04
mm4_intron_1700007B14Rik_chr8_75881263_R Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Cd47|Gm8824_chr16_50080516_F TCGTCGGCAGCGTCGCCCATGCCAATATGCACAG 59.9 0.03
mm3_intergenic_Cd47|Gm8824_chr16_50080516_R GTCTCGTGGGCTCGGTTCTCCGCATACACCAGCAG 60.1 0.03
mm3_intergenic_Gm21846|6030443J06Rik_chr5_22794772_F Primer3: not found at this Tm N.d. 0.03
mm3_intergenic_Gm21846|6030443J06Rik_chr5_22794772_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm23829|Gm5974_chr1_48125463_F TCGTCGGCAGCGTCTGTCTTCCACACACACACACA 59.9 0.03
mm4_intergenic_Gm23829|Gm5974_chr1_48125463_R GTCTCGTGGGCTCGGTTTGCTGAGCTCTCAAGGTT 57.3 0.03
mm3_intergenic_Gm25460|Gm5263_chr1_146079367_F TCGTCGGCAGCGTCAGGTTTGTGGTGGTCCAATGT 60.0 0.03
mm3_intergenic_Gm25460|Gm5263_chr1_146079367_R GTCTCGTGGGCTCGGTCTGCCACCATATCACGCTC 59.8 0.03
mm4_intron_Dok6_chr18_89344776_F Primer3: not found at this Tm N.d. 0.03
mm4_intron_Dok6_chr18_89344776_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Depdc5|Ywhah_chr5_33001084_F TCGTCGGCAGCGTCAAACCAAGGGTCCCAAGTGG 60.1 0.03
mm4_intergenic_Depdc5|Ywhah_chr5_33001084_R GTCTCGTGGGCTCGGGCAGATGCAGAGCAGAGTCA 60.1 0.03
mm3_intergenic_Wisp3|Fyn_chr10_39210407_F TCGTCGGCAGCGTCCACCCTCATGCTACAGAGTCA 59.1 0.03
mm3_intergenic_Wisp3|Fyn_chr10_39210407_R GTCTCGTGGGCTCGGTCATGTGCCAAAGCTACCCC 60.3 0.03
mm4_intron_Myt1l_chr12_29639786_F Primer3: not found at this Tm N.d. 0.03
mm4_intron_Myt1l_chr12_29639786_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm13888|AI314831_chr2_105045993_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm13888|AI314831_chr2_105045993_R Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Btla|Cd200_chr16_45381211_F Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Btla|Cd200_chr16_45381211_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm24635|Arrdc3_chr13_80251308_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm24635|Arrdc3_chr13_80251308_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Gsg1l_chr7_126054080_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Gsg1l_chr7_126054080_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm23892|Gm25382_chr10_16260348_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm23892|Gm25382_chr10_16260348_R Primer3: not found at this Tm N.d. 0.02
mm4_exon_Abcb8_chr5_24408572_F TCGTCGGCAGCGTCCCCCTGTCCTGTCCTCTCTT 60.2 0.02
mm4_exon_Abcb8_chr5_24408572_R GTCTCGTGGGCTCGGCTCGTCCAGGATCAGCACTG 60.1 0.02
mm2_intron_Pus10_chr11_23713780_F Primer3: not found at this Tm N.d. 0.02
mm2_intron_Pus10_chr11_23713780_R Primer3: not found at this Tm N.d. 0.02
mm4_intron_Dhx29_chr13_112952443_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Dhx29_chr13_112952443_R Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Gm23422|Spag16_chr1_70699545_F Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Gm23422|Spag16_chr1_70699545_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Bahcc1|Actg1_chr11_120295933_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Bahcc1|Actg1_chr11_120295933_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Map1b_chr13_99466263_F TCGTCGGCAGCGTCCACACTGCCTCAGTCCAGAG 60.0 0.01
mm4_intron_Map1b_chr13_99466263_R GTCTCGTGGGCTCGGGGGAGGGGTGTTGTCAGAAC 60.2 0.01
mm4_intron_Nmnat2_chr1_153084738_F Primer3: not found at this Tm N.d. 0.01
mm4_intron_Nmnat2_chr1_153084738_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Csmd3_chr15_48791689_F TCGTCGGCAGCGTCGCTTGCTAGCCTCTCTCAGG 59.8 0.01
mm4_intron_Csmd3_chr15_48791689_R GTCTCGTGGGCTCGGACGTTTTGGAACCTCGTCTT 57.6 0.01
mm4_intergenic_E130006D01Rik|Miat/MIAT_exon5_3/MIAT_exon5_2/Gm26953/MIAT_exon5_1_chr5_111886854_F TCGTCGGCAGCGTCAAGTCCCCACATGTCACACC 59.8 0.01
mm4_intergenic_E130006D01Rik|Miat/MIAT_exon5_3/MIAT_exon5_2/Gm26953/MIAT_exon5_1_chr5_111886854_R GTCTCGTGGGCTCGGGTGCCCATAGAGTCTGTGCA 59.7 0.01
mm4_intergenic_4930474N05Rik|Gm24394_chr14_36607221_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_4930474N05Rik|Gm24394_chr14_36607221_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Crtac1_chr19_42317038_F TCGTCGGCAGCGTCGTGTCCTCTGGGTATGCCAG 59.8 0.01
mm4_intron_Crtac1_chr19_42317038_R GTCTCGTGGGCTCGGTGCTGGAAGGATAGGGCAAC 59.7 0.01
mm2_intron_Zyg11b_chr4_108287828_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zyg11b_chr4_108287828_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp933_chr4_147836816_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp933_chr4_147836816_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp69_chr4_120939457_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp69_chr4_120939457_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp277_chr12_40405872_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Zfp277_chr12_40405872_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Xpnpep1_chr19_52987530_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Xpnpep1_chr19_52987530_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wwox_chr8_115285705_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wwox_chr8_115285705_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr70_chr15_7914676_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr70_chr15_7914676_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr63_chr3_146087057_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr63_chr3_146087057_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr49_chr3_75420639_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr49_chr3_75420639_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr27_chr17_14868196_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Wdr27_chr17_14868196_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vrk2_chr11_26557409_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vrk2_chr11_26557409_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vmn2r60_chr7_42174095_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vmn2r60_chr7_42174095_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vmn2r38_chr7_9079320_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vmn2r38_chr7_9079320_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vegfc_chr8_54146187_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Vegfc_chr8_54146187_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tubgcp2_chr7_140018017_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tubgcp2_chr7_140018017_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ttc27_chr17_74762401_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ttc27_chr17_74762401_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ttbk2/Cdan1_chr2_120817720_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ttbk2/Cdan1_chr2_120817720_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trpm2_chr10_77954542_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trpm2_chr10_77954542_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trpc6_chr9_8630247_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trpc6_chr9_8630247_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trim5_chr7_104270164_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trim5_chr7_104270164_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trak1_chr9_121409713_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Trak1_chr9_121409713_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem232_chr17_65465509_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem232_chr17_65465509_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem163_chr1_127561585_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem163_chr1_127561585_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem132b_chr5_125718680_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmem132b_chr5_125718680_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmcc3_chr10_94365889_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tmcc3_chr10_94365889_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tll2_chr19_41146571_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tll2_chr19_41146571_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tek_chr4_94815750_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tek_chr4_94815750_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tcerg1l_chr7_138263766_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tcerg1l_chr7_138263766_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tbc1d22a_chr15_86315583_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Tbc1d22a_chr15_86315583_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Snd1_chr6_28927468_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Snd1_chr6_28927468_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slco1a6_chr6_142152739_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slco1a6_chr6_142152739_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc4a4_chr5_89004214_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc4a4_chr5_89004214_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc2a9_chr5_38409527_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc2a9_chr5_38409527_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc2a12_chr10_22686583_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc2a12_chr10_22686583_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc24a3_chr2_145628591_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc24a3_chr2_145628591_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc20a2_chr8_22554932_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc20a2_chr8_22554932_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc15a2_chr16_36768391_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Slc15a2_chr16_36768391_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sirt5_chr13_43390549_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sirt5_chr13_43390549_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sgsm2_chr11_74888180_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sgsm2_chr11_74888180_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sgip1_chr4_102878975_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sgip1_chr4_102878975_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sesn1_chr10_41844311_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sesn1_chr10_41844311_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sdk2_chr11_113915979_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Sdk2_chr11_113915979_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Scg5_chr2_113813246_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Scg5_chr2_113813246_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Scarb2_chr5_92479861_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Scarb2_chr5_92479861_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rnf157_chr11_116391333_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rnf157_chr11_116391333_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rgs3_chr4_62575689_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rgs3_chr4_62575689_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rgl1_chr1_152664771_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rgl1_chr1_152664771_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rftn1_chr17_50076927_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rftn1_chr17_50076927_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Reln_chr5_22203059_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Reln_chr5_22203059_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Raver2_chr4_101127360_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Raver2_chr4_101127360_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rapgef6_chr11_54579893_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rapgef6_chr11_54579893_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rap1gap2_chr11_74542016_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rap1gap2_chr11_74542016_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rab3gap1_chr1_127895347_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rab3gap1_chr1_127895347_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rab3gap1_chr1_127878384_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Rab3gap1_chr1_127878384_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Psmg4_chr13_34170123_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Psmg4_chr13_34170123_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Prnp_chr2_131927221_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Prnp_chr2_131927221_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ppm1h_chr10_122836065_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ppm1h_chr10_122836065_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Poteg_chr8_27468365_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Poteg_chr8_27468365_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pot1b_chr17_55680014_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pot1b_chr17_55680014_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pld1_chr3_28066063_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pld1_chr3_28066063_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pkd1l2_chr8_117003921_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pkd1l2_chr8_117003921_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pik3c2g_chr6_139829442_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pik3c2g_chr6_139829442_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Phf8_chrX_151581467_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Phf8_chrX_151581467_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pet112_chr3_85625602_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pet112_chr3_85625602_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pdzrn4_chr15_92726135_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pdzrn4_chr15_92726135_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pde4d_chr13_109855492_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pde4d_chr13_109855492_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pcdha2_chr18_36984835_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pcdha2_chr18_36984835_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Park2_chr17_11101186_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Park2_chr17_11101186_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pard3b_chr1_62537434_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pard3b_chr1_62537434_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pag1_chr3_9734986_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Pag1_chr3_9734986_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Osbpl10_chr9_115081367_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Osbpl10_chr9_115081367_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Opcml_chr9_27978311_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Opcml_chr9_27978311_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nudcd3_chr11_6144810_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nudcd3_chr11_6144810_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nsdhl_chrX_72945763_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nsdhl_chrX_72945763_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrxn1_chr17_90106221_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrxn1_chr17_90106221_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrros_chr16_32149985_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrros_chr16_32149985_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrg3_chr14_38458856_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nrg3_chr14_38458856_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nipal3_chr4_135459546_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nipal3_chr4_135459546_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nipa2_chr7_55950610_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nipa2_chr7_55950610_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nell1_chr7_50235663_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nell1_chr7_50235663_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nek1_chr8_61002115_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nek1_chr8_61002115_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nebl_chr2_17614567_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nebl_chr2_17614567_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nckap5_chr1_126426315_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Nckap5_chr1_126426315_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mrgprx2_chr7_48490608_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mrgprx2_chr7_48490608_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mpp7_chr18_7531341_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mpp7_chr18_7531341_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mnd1_chr3_84145762_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mnd1_chr3_84145762_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mmrn2_chr14_34387081_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mmrn2_chr14_34387081_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mier3_chr13_111697568_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mier3_chr13_111697568_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mei4_chr9_81909152_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mei4_chr9_81909152_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Me3_chr7_89822635_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Me3_chr7_89822635_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mc2r_chr18_68416053_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mc2r_chr18_68416053_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mast4_chr13_102830915_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Mast4_chr13_102830915_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Macrod2_chr2_142200465_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Macrod2_chr2_142200465_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc8d_chr5_105727467_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc8d_chr5_105727467_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc8b_chr5_105422685_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc8b_chr5_105422685_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc2_chr9_110973835_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrrc2_chr9_110973835_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrp1b_chr2_41748112_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lrp1b_chr2_41748112_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lphn3_chr5_81381479_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Lphn3_chr5_81381479_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Larp6_chr9_60729511_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Larp6_chr9_60729511_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_L3mbtl4_chr17_68300583_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_L3mbtl4_chr17_68300583_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Klhl1_chr14_96287671_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Klhl1_chr14_96287671_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kif24_chr4_41456627_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kif24_chr4_41456627_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnu1_chr8_25874777_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnu1_chr8_25874777_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcns3_chr12_11106974_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcns3_chr12_11106974_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnn2_chr18_45360788_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnn2_chr18_45360788_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnh6_chr11_106031575_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kcnh6_chr11_106031575_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kalrn_chr16_34022543_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Kalrn_chr16_34022543_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Itgb5_chr16_33850590_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Itgb5_chr16_33850590_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Inadl_chr4_98528178_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Inadl_chr4_98528178_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ica1_chr6_8699908_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ica1_chr6_8699908_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Hsf3_chrX_96349692_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Hsf3_chrX_96349692_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Hlcs_chr16_94278635_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Hlcs_chr16_94278635_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_H2-T24_chr17_36010923_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_H2-T24_chr17_36010923_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gsap_chr5_21238713_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gsap_chr5_21238713_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Grid2_chr6_64157800_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Grid2_chr6_64157800_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpsm1_chr2_26336527_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpsm1_chr2_26336527_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117859504_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117859504_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117289065_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117289065_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117182754_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gpc6_chr14_117182754_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm9864_chr2_107597365_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm9864_chr2_107597365_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm7995_chr14_42317389_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm7995_chr14_42317389_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm4954_chr1_166766458_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm4954_chr1_166766458_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm4788_chr1_139726734_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm4788_chr1_139726734_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm3972_chr7_9482597_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm3972_chr7_9482597_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm3164_chr14_4435527_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm3164_chr14_4435527_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm2244_chr14_19544956_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm2244_chr14_19544956_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm15514_chr7_107267729_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm15514_chr7_107267729_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm15155_chrX_155852519_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm15155_chrX_155852519_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14957_chrX_126147319_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14957_chrX_126147319_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14951_chrX_123256670_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14951_chrX_123256670_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14527_chrX_29633812_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14527_chrX_29633812_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14459_chrX_8519738_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14459_chrX_8519738_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14149_chr2_151208702_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm14149_chr2_151208702_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13849_chr6_31802698_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13849_chr6_31802698_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13768_chr2_90182197_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13768_chr2_90182197_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13767_chr2_90364472_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13767_chr2_90364472_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13710_chr2_84507099_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13710_chr2_84507099_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13235_chr4_145885071_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm13235_chr4_145885071_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm12132_chr11_40067044_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm12132_chr11_40067044_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm11751_chr4_68117383_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm11751_chr4_68117383_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm10338_chr14_7590742_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm10338_chr14_7590742_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm10040_chr3_68736315_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gm10040_chr3_68736315_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gfod1_chr13_43281339_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gfod1_chr13_43281339_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gbe1_chr16_70544400_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gbe1_chr16_70544400_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Garem_chr18_21265527_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Garem_chr18_21265527_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gabrg3_chr7_57141795_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Gabrg3_chr7_57141795_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Frmd4b_chr6_97376112_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Frmd4b_chr6_97376112_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fras1_chr5_96488861_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fras1_chr5_96488861_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fmo1_chr1_162844318_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fmo1_chr1_162844318_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fhit_chr14_9732548_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fhit_chr14_9732548_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fam135b_chr15_71601803_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Fam135b_chr15_71601803_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_F13a1_chr13_37040523_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_F13a1_chr13_37040523_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Exoc6_chr19_37620722_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Exoc6_chr19_37620722_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Exoc4_chr6_33747571_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Exoc4_chr6_33747571_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Enpp6_chr8_47087429_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Enpp6_chr8_47087429_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Enpp1_chr10_24688244_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Enpp1_chr10_24688244_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ehbp1_chr11_22338573_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ehbp1_chr11_22338573_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dph5_chr3_115911082_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dph5_chr3_115911082_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dnah6_chr6_73216470_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dnah6_chr6_73216470_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dlg2_chr7_92228605_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dlg2_chr7_92228605_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dctn4_chr18_60531735_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dctn4_chr18_60531735_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dcaf5_chr12_80421075_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Dcaf5_chr12_80421075_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cyp2j13_chr4_96052525_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cyp2j13_chr4_96052525_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cwf19l2_chr9_3464617_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cwf19l2_chr9_3464617_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ctps2_chrX_162981968_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ctps2_chrX_162981968_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cpne8_chr15_90639786_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cpne8_chr15_90639786_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cntnap5a_chr1_115888688_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cntnap5a_chr1_115888688_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cntnap3_chr13_64882034_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cntnap3_chr13_64882034_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cmc2_chr8_116900106_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cmc2_chr8_116900106_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Clec4a3_chr6_122958661_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Clec4a3_chr6_122958661_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ces2h_chr8_105004579_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ces2h_chr8_105004579_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cep112_chr11_108651844_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cep112_chr11_108651844_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Celf2_chr2_7406011_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Celf2_chr2_7406011_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdk5rap1_chr2_154356211_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdk5rap1_chr2_154356211_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdh18_chr15_23243695_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdh18_chr15_23243695_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdh13_chr8_119049009_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdh13_chr8_119049009_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdcp1_chr9_123194152_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cdcp1_chr9_123194152_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cd28_chr1_60728170_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cd28_chr1_60728170_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ccdc15_chr9_37335127_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ccdc15_chr9_37335127_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ccdc158_chr5_92618428_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ccdc158_chr5_92618428_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Casp8_chr1_58814984_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Casp8_chr1_58814984_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Capn11_chr17_45646584_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Capn11_chr17_45646584_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Camk1d_chr2_5687809_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Camk1d_chr2_5687809_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cacna2d1_chr5_16288212_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Cacna2d1_chr5_16288212_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_C130060K24Rik_chr6_65388140_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_C130060K24Rik_chr6_65388140_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Btbd3_chr2_138577112_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Btbd3_chr2_138577112_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Bst1_chr5_43832154_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Bst1_chr5_43832154_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Bank1_chr3_136177559_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Bank1_chr3_136177559_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_BC117090_chr16_36328132_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_BC117090_chr16_36328132_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Atrnl1_chr19_57830452_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Atrnl1_chr19_57830452_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arhgef38_chr3_133127384_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arhgef38_chr3_133127384_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arhgef28_chr13_98086740_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arhgef28_chr13_98086740_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arfgef2_chr2_166815515_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Arfgef2_chr2_166815515_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Apoh_chr11_108402451_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Apoh_chr11_108402451_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Aox2_chr1_58326676_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Aox2_chr1_58326676_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Anks1b_chr10_90327927_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Anks1b_chr10_90327927_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ankrd22_chr19_34134924_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Ankrd22_chr19_34134924_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Akap6_chr12_52733421_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Akap6_chr12_52733421_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Agtr1a_chr13_30373909_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Agtr1a_chr13_30373909_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Agbl4_chr4_111573742_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Agbl4_chr4_111573742_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adk_chr14_21364310_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adk_chr14_21364310_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adarb2_chr13_8472934_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adarb2_chr13_8472934_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adam5_chr8_24771239_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Adam5_chr8_24771239_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_Abhd2_chr7_79340531_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_Abhd2_chr7_79340531_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4933406I18Rik_chr7_114408261_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4933406I18Rik_chr7_114408261_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932443I19Rik_chr8_13721141_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932443I19Rik_chr8_13721141_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932443I19Rik_chr8_13713745_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932443I19Rik_chr8_13713745_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932441J04Rik_chr5_57693253_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4932441J04Rik_chr5_57693253_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4930544M13Rik_chr13_114625564_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4930544M13Rik_chr13_114625564_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_4930449A18Rik_chr3_59800326_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_4930449A18Rik_chr3_59800326_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_2210408I21Rik_chr13_77601506_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_2210408I21Rik_chr13_77601506_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_2210408I21Rik_chr13_77231360_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_2210408I21Rik_chr13_77231360_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_2010111I01Rik_chr13_63221333_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_2010111I01Rik_chr13_63221333_R Primer3: not found at this Tm N.d. 0.01
mm2_intron_2010111I01Rik_chr13_63159903_F Primer3: not found at this Tm N.d. 0.01
mm2_intron_2010111I01Rik_chr13_63159903_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_pRNA|Gap_chr1_195324115_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_pRNA|Gap_chr1_195324115_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s61|Gm15571_chr12_68747159_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s61|Gm15571_chr12_68747159_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s61|Gm15571_chr12_68625100_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s61|Gm15571_chr12_68625100_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s5|Gm14883_chrX_18339027_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s5|Gm14883_chrX_18339027_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s42|Fam19a5_chr15_87297746_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s42|Fam19a5_chr15_87297746_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s209|Gm7846_chr1_27183909_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_n-R5s209|Gm7846_chr1_27183909_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6394|Gm15412_chr7_96320912_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6394|Gm15412_chr7_96320912_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6343|Gm25974_chr1_76776028_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6343|Gm25974_chr1_76776028_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6342|Gm23771_chr1_29946034_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-mir-6342|Gm23771_chr1_29946034_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-let-7j|Gm6214_chr3_140380349_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-let-7j|Gm6214_chr3_140380349_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-let-7j|Gm6214_chr3_140121950_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_mmu-let-7j|Gm6214_chr3_140121950_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zswim6|Smim15_chr13_108001064_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zswim6|Smim15_chr13_108001064_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zscan4b|Mir297-1_chr7_10913141_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zscan4b|Mir297-1_chr7_10913141_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zscan25|Cyp3a57_chr5_145333809_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zscan25|Cyp3a57_chr5_145333809_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp946|Vmn2r111_chr17_22491294_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp946|Vmn2r111_chr17_22491294_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp781|Zfp873_chr10_81971661_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp781|Zfp873_chr10_81971661_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp629|Bcl7c_chr7_127622666_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp629|Bcl7c_chr7_127622666_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp516|Gm24720_chr18_83174964_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp516|Gm24720_chr18_83174964_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp385c|Gm11547_chr11_100666203_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zfp385c|Gm11547_chr11_100666203_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zdhhc19|Gm5405_chr16_32583043_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zdhhc19|Gm5405_chr16_32583043_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zcchc6|Gas1_chr13_60024923_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zcchc6|Gas1_chr13_60024923_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zc3h13|Siah3_chr14_75429077_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Zc3h13|Siah3_chr14_75429077_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Xrcc1|Zfp575_chr7_24580373_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Xrcc1|Zfp575_chr7_24580373_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Xkr6/Gm15918|Xkr6_chr14_63645674_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Xkr6/Gm15918|Xkr6_chr14_63645674_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Wdr11|Gm23847_chr7_129736856_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Wdr11|Gm23847_chr7_129736856_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Wac|Gm5819_chr18_8015381_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Wac|Gm5819_chr18_8015381_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vnn3|Vnn1_chr10_23874639_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vnn3|Vnn1_chr10_23874639_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r22|Vmn2r23_chr6_123681210_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r22|Vmn2r23_chr6_123681210_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r120|Gm21834_chr17_57736058_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r120|Gm21834_chr17_57736058_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r117|Casp16_chr17_23498606_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r117|Casp16_chr17_23498606_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps81|Vmn2r-ps82_chr7_86035569_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps81|Vmn2r-ps82_chr7_86035569_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps78|Vmn2r74_chr7_85929733_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps78|Vmn2r74_chr7_85929733_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps69|Vmn2r69_chr7_85362550_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps69|Vmn2r69_chr7_85362550_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps45|Gm7696_chr7_8345342_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps45|Gm7696_chr7_8345342_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps2|Gm13506_chr2_39364436_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn2r-ps2|Gm13506_chr2_39364436_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r9|Vmn1r10_chr6_57090045_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r9|Vmn1r10_chr6_57090045_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r189|Vmn1r-ps95_chr13_22118775_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r189|Vmn1r-ps95_chr13_22118775_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r168|Vmn1r169_chr7_23555301_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r168|Vmn1r169_chr7_23555301_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps75|Gm6882_chr7_21409450_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps75|Gm6882_chr7_21409450_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps6|Samd9l_chr6_3253381_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps6|Samd9l_chr6_3253381_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps6|Samd9l_chr6_3187950_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps6|Samd9l_chr6_3187950_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps150|Zfp677_chr17_21342153_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Vmn1r-ps150|Zfp677_chr17_21342153_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ust|Gm24374_chr10_8603048_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ust|Gm24374_chr10_8603048_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Usp32|Gm11440_chr11_85064486_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Usp32|Gm11440_chr11_85064486_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc93a|Smok2a_chr17_13156457_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc93a|Smok2a_chr17_13156457_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc5d|4933433F19Rik_chr8_30020628_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc5d|4933433F19Rik_chr8_30020628_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc5d|4933433F19Rik_chr8_29517309_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Unc5d|4933433F19Rik_chr8_29517309_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ulk4|Trak1_chr9_121324630_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ulk4|Trak1_chr9_121324630_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ube2e2|Gm8582_chr14_19009187_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ube2e2|Gm8582_chr14_19009187_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ttc27|Ltbp1_chr17_74909425_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ttc27|Ltbp1_chr17_74909425_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trim2|Fhdc1_chr3_84362481_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trim2|Fhdc1_chr3_84362481_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trav8-1|Trav9-1_chr14_53478255_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trav8-1|Trav9-1_chr14_53478255_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trav6d-4|Trav7d-4_chr14_52761207_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trav6d-4|Trav7d-4_chr14_52761207_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trappc9|Chrac1_chr15_73084174_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Trappc9|Chrac1_chr15_73084174_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpk1|Gm22939_chr6_43788671_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpk1|Gm22939_chr6_43788671_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpd52|Zbtb10_chr3_9093406_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpd52|Zbtb10_chr3_9093406_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpd52l1|Rnf217_chr10_31486386_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpd52l1|Rnf217_chr10_31486386_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpbg|Ube2cbp_chr9_86066063_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tpbg|Ube2cbp_chr9_86066063_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tnr|Gm24719_chr1_159973084_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tnr|Gm24719_chr1_159973084_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmx1|Gm24474_chr12_70664480_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmx1|Gm24474_chr12_70664480_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmprss15|Rps19-ps12_chr16_79372021_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmprss15|Rps19-ps12_chr16_79372021_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem28|Eda_chrX_99904876_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem28|Eda_chrX_99904876_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem200c|Epb4.1l3_chr17_68944955_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem200c|Epb4.1l3_chr17_68944955_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem17|Gm26829_chr11_22579667_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmem17|Gm26829_chr11_22579667_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmed10|Fos_chr12_85404341_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tmed10|Fos_chr12_85404341_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tiam1|Sod1_chr16_90059658_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tiam1|Sod1_chr16_90059658_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Thumpd2|Slc8a1_chr17_81159713_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Thumpd2|Slc8a1_chr17_81159713_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Thbd|Gm14119_chr2_148412548_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Thbd|Gm14119_chr2_148412548_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tfap2c|Gm22773_chr2_172747607_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tfap2c|Gm22773_chr2_172747607_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tecrl|Gm25765_chr5_83589514_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tecrl|Gm25765_chr5_83589514_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tdrd3|Rps3a2_chr14_88037030_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tdrd3|Rps3a2_chr14_88037030_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcl1|2810011L19Rik_chr12_105303542_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcl1|2810011L19Rik_chr12_105303542_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcf7l2|Gm22271_chr19_55980526_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcf7l2|Gm22271_chr19_55980526_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcerg1l|Mapk1ip1_chr7_138692309_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tcerg1l|Mapk1ip1_chr7_138692309_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbx5|n-R5s176_chr5_119901773_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbx5|n-R5s176_chr5_119901773_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbx15|Gm12449_chr3_99419133_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbx15|Gm12449_chr3_99419133_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbc1d1|Gm25306_chr5_64561277_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tbc1d1|Gm25306_chr5_64561277_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tap2|H2-Ob_chr17_34229613_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tap2|H2-Ob_chr17_34229613_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tap2|H2-Ob_chr17_34220833_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Tap2|H2-Ob_chr17_34220833_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Suv39h2|Hspa14_chr2_3486848_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Suv39h2|Hspa14_chr2_3486848_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Susd5|4921528I07Rik_chr9_114104878_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Susd5|4921528I07Rik_chr9_114104878_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sub1|Zfr_chr15_12059319_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sub1|Zfr_chr15_12059319_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stpg2|mmu-let-7j_chr3_140023709_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stpg2|mmu-let-7j_chr3_140023709_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stmnd1|Rbm24_chr13_46379499_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stmnd1|Rbm24_chr13_46379499_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stmn4|Gm23899_chr14_66466466_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stmn4|Gm23899_chr14_66466466_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stk36|Ttll4_chr1_74656752_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stk36|Ttll4_chr1_74656752_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stc2|Bod1_chr11_31450882_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Stc2|Bod1_chr11_31450882_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_St6galnac1|Mxra7_chr11_116789346_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_St6galnac1|Mxra7_chr11_116789346_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sppl2a|Ap4e1_chr2_126968321_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sppl2a|Ap4e1_chr2_126968321_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Spock3|Gm5350_chr8_63742770_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Spock3|Gm5350_chr8_63742770_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Spata6|Slc5a9_chr4_111837139_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Spata6|Slc5a9_chr4_111837139_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sox2ot|mmu-mir-6378_chr3_34849749_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sox2ot|mmu-mir-6378_chr3_34849749_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Snx29|Gm4279_chr16_11682023_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Snx29|Gm4279_chr16_11682023_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Snx19|Adamts15_chr9_30645592_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Snx19|Adamts15_chr9_30645592_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sntb1|Has2_chr15_56179677_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sntb1|Has2_chr15_56179677_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Smok2b|Gm26500_chr17_13246132_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Smok2b|Gm26500_chr17_13246132_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Smlr1|Tmem200a_chr10_25972186_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Smlr1|Tmem200a_chr10_25972186_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slitrk6|Gm22802_chr14_110864239_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slitrk6|Gm22802_chr14_110864239_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slco6c1|D1Ertd622e_chr1_97176030_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slco6c1|D1Ertd622e_chr1_97176030_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc36a1|Fat2_chr11_55244256_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc36a1|Fat2_chr11_55244256_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc35f3|Coa6_chr8_126415479_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc35f3|Coa6_chr8_126415479_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc1a6|Olfr1356_chr10_78819773_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Slc1a6|Olfr1356_chr10_78819773_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sipa1l2|Map10_chr8_125633102_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sipa1l2|Map10_chr8_125633102_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sipa1l1|Gm5435_chr12_82464407_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sipa1l1|Gm5435_chr12_82464407_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sgms1/2700046G09Rik|Rpl9-ps6_chr19_32445632_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sgms1/2700046G09Rik|Rpl9-ps6_chr19_32445632_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sfrp1|Zmat4_chr8_23547529_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sfrp1|Zmat4_chr8_23547529_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Serpinb6e|Serpinb6c_chr13_33865783_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Serpinb6e|Serpinb6c_chr13_33865783_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sema6a|Gm5506_chr18_47773810_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sema6a|Gm5506_chr18_47773810_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sema6a|Gm5506_chr18_47652068_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Sema6a|Gm5506_chr18_47652068_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scnn1g|Scnn1b_chr7_121852709_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scnn1g|Scnn1b_chr7_121852709_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn7a|Gm13600_chr2_66848927_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn7a|Gm13600_chr2_66848927_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn11a|Gm2449_chr9_119872378_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn11a|Gm2449_chr9_119872378_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn11a|Gm2449_chr9_119865676_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Scn11a|Gm2449_chr9_119865676_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Schip1|Gm10292_chr3_68116266_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Schip1|Gm10292_chr3_68116266_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Satb1|RP24-465O15.1_chr17_51868184_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Satb1|RP24-465O15.1_chr17_51868184_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_SMAD5-AS1_4|Smad5_chr13_56716194_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_SMAD5-AS1_4|Smad5_chr13_56716194_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rxfp4|2810403A07Rik_chr3_88670166_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rxfp4|2810403A07Rik_chr3_88670166_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps19-ps12|Gm23083_chr16_79945088_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps19-ps12|Gm23083_chr16_79945088_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps18-ps1|Gm11231_chr4_71512361_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps18-ps1|Gm11231_chr4_71512361_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps12-ps22|Gm6604_chrX_123564324_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rps12-ps22|Gm6604_chrX_123564324_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl35a-ps2|Cnih3_chr1_181266844_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl35a-ps2|Cnih3_chr1_181266844_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl28-ps4|Gm9946_chr6_117338083_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl28-ps4|Gm9946_chr6_117338083_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl21-ps14|n-R5s93_chr8_4889443_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl21-ps14|n-R5s93_chr8_4889443_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl13a-ps1|Sorcs1_chr19_50110602_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl13a-ps1|Sorcs1_chr19_50110602_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl10l|Mdga2/MDGA2_chr12_66410347_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl10l|Mdga2/MDGA2_chr12_66410347_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl10-ps1|Pax6os1_chr2_105559746_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rpl10-ps1|Pax6os1_chr2_105559746_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf223|Agrn_chr4_156143282_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf223|Agrn_chr4_156143282_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf219|Gm22021_chr14_104585937_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf219|Gm22021_chr14_104585937_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf183|Wdr31_chr4_62445704_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rnf183|Wdr31_chr4_62445704_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ripk4|Prdm15_chr16_97773858_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ripk4|Prdm15_chr16_97773858_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgs1|Rgs21_chr1_144387936_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgs1|Rgs21_chr1_144387936_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgs18|Gm22681_chr1_144858013_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgs18|Gm22681_chr1_144858013_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgag1|Gm4760_chrX_143175911_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rgag1|Gm4760_chrX_143175911_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbpsuh-rs3|Cntnap2_chr6_46681825_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbpsuh-rs3|Cntnap2_chr6_46681825_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbp1|Rbp2_chr9_98454705_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbp1|Rbp2_chr9_98454705_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbm26|Gm22290_chr14_105210934_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbm26|Gm22290_chr14_105210934_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbm11|Gm15553_chr16_75637980_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbm11|Gm15553_chr16_75637980_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbfox1|Gm23476_chr16_8037331_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rbfox1|Gm23476_chr16_8037331_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rasa1|Cox7c_chr13_85602161_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rasa1|Cox7c_chr13_85602161_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rapgef4|Zak_chr2_72273668_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rapgef4|Zak_chr2_72273668_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rap1b|Mdm1_chr10_118074419_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rap1b|Mdm1_chr10_118074419_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ralyl|Gm25981_chr3_13824623_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ralyl|Gm25981_chr3_13824623_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ralyl|Gm23112_chr3_14238227_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ralyl|Gm23112_chr3_14238227_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rad51b|Zfp36l1/Gm26669_chr12_79565159_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rad51b|Zfp36l1/Gm26669_chr12_79565159_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rabgap1l|Gm24988_chr1_160819198_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rabgap1l|Gm24988_chr1_160819198_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab39|Slc35f2_chr9_53731823_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab39|Slc35f2_chr9_53731823_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab18|Mkx_chr18_6864592_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab18|Mkx_chr18_6864592_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab10|Gm26520_chr12_3334127_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Rab10|Gm26520_chr12_3334127_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-86O15.2|Gm10698_chr9_33157098_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-86O15.2|Gm10698_chr9_33157098_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-376I11.1|RP23-402M18.1_chr9_74637501_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-376I11.1|RP23-402M18.1_chr9_74637501_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-194K24.8|RP23-263E7.6_chr7_14975491_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP24-194K24.8|RP23-263E7.6_chr7_14975491_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-93M1.2|RP24-308I2.1_chr9_32892526_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-93M1.2|RP24-308I2.1_chr9_32892526_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-93M1.2|RP24-308I2.1_chr9_32842646_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-93M1.2|RP24-308I2.1_chr9_32842646_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-447L9.1|Gm24442_chr6_4364944_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-447L9.1|Gm24442_chr6_4364944_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-362A12.1|Gm21911_chr7_106313123_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-362A12.1|Gm21911_chr7_106313123_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-339G10.1|Unc13c_chr9_73409074_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-339G10.1|Unc13c_chr9_73409074_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-339G10.1|Unc13c_chr9_73299711_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_RP23-339G10.1|Unc13c_chr9_73299711_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ptpn12|Gm22490_chr5_21104481_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ptpn12|Gm22490_chr5_21104481_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ptger4|AC133283.1_chr15_5382143_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ptger4|AC133283.1_chr15_5382143_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Psd3|Gm15992_chr8_67796743_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Psd3|Gm15992_chr8_67796743_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prss23|Gm2546_chr7_89571898_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prss23|Gm2546_chr7_89571898_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prl4a1|Prl5a1_chr13_28127721_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prl4a1|Prl5a1_chr13_28127721_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prdm8/A730035I17Rik|Fgf5_chr5_98208046_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Prdm8/A730035I17Rik|Fgf5_chr5_98208046_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp4r2|Pdzrn3_chr6_101141718_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp4r2|Pdzrn3_chr6_101141718_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp2r3a|Gm24638_chr9_101294507_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp2r3a|Gm24638_chr9_101294507_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp1r2-ps7|Gm26131_chrX_22567273_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp1r2-ps7|Gm26131_chrX_22567273_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp1r2-ps1|Dynlt1b_chr17_6348182_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppp1r2-ps1|Dynlt1b_chr17_6348182_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppapdc1a|Wdr11_chr7_129562884_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ppapdc1a|Wdr11_chr7_129562884_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pou3f4|Cylc1_chrX_110864182_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pou3f4|Cylc1_chrX_110864182_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Polr3b|Rfx4_chr10_84746550_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Polr3b|Rfx4_chr10_84746550_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Polr1a|Gm26628/Polr1a_chr6_71958770_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Polr1a|Gm26628/Polr1a_chr6_71958770_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pof1b|Gm14922/Gm14923_chrX_112745380_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pof1b|Gm14922/Gm14923_chrX_112745380_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92738037_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92738037_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92650666_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92650666_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92628198_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plod2|Gm9621_chr9_92628198_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plk2|Actbl2_chr13_111069774_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plk2|Actbl2_chr13_111069774_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plekhm3|Rpl10a-ps1_chr1_64963632_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Plekhm3|Rpl10a-ps1_chr1_64963632_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pld5|Gm26104_chr1_176546387_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pld5|Gm26104_chr1_176546387_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120220798_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120220798_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pigyl|Rpl15-ps3_chr9_22180761_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pigyl|Rpl15-ps3_chr9_22180761_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pigk|St6galnac5_chr3_152804905_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pigk|St6galnac5_chr3_152804905_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Phyhipl|4930533K18Rik_chr10_70795195_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Phyhipl|4930533K18Rik_chr10_70795195_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfpl|Mpeg1_chr19_12450770_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfpl|Mpeg1_chr19_12450770_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfkl|Aire_chr10_78022232_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfkl|Aire_chr10_78022232_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfdn1|Hbegf_chr18_36477310_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pfdn1|Hbegf_chr18_36477310_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Per2|Traf3ip1_chr1_91474537_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Per2|Traf3ip1_chr1_91474537_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pea15b|Gm22011_chr5_77562964_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pea15b|Gm22011_chr5_77562964_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdlim3|Ccdc110_chr8_45926470_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdlim3|Ccdc110_chr8_45926470_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdk4|Dync1i1_chr6_5611367_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdk4|Dync1i1_chr6_5611367_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdk1|Gm13746_chr2_71945435_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pdk1|Gm13746_chr2_71945435_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pced1b|Rpap3_chr15_97553543_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pced1b|Rpap3_chr15_97553543_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdhb8|Pcdhb9_chr18_37367981_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdhb8|Pcdhb9_chr18_37367981_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdh17|Gm23926_chr14_85892856_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdh17|Gm23926_chr14_85892856_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdh17|Gm23926_chr14_84858455_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pcdh17|Gm23926_chr14_84858455_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pabpc6|Qk_chr17_9783884_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Pabpc6|Qk_chr17_9783884_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_PISRT1|Prr23a_chr9_98768365_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_PISRT1|Prr23a_chr9_98768365_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_P4ha1|Gm10273_chr10_59383707_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_P4ha1|Gm10273_chr10_59383707_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_P2ry1|B430305J03Rik/Rap2b_chr3_61272790_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_P2ry1|B430305J03Rik/Rap2b_chr3_61272790_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Otud7a|Klf13_chr7_63807420_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Otud7a|Klf13_chr7_63807420_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Otogl|Ppp1r12a_chr10_108003268_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Otogl|Ppp1r12a_chr10_108003268_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olig3|Ifngr1_chr10_19542215_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olig3|Ifngr1_chr10_19542215_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr972|Olfr229_chr9_39896987_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr972|Olfr229_chr9_39896987_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr784|Olfr786_chr10_129392140_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr784|Olfr786_chr10_129392140_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr761|Gm18522_chr17_37957741_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr761|Gm18522_chr17_37957741_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr497|Olfr498_chr7_108431136_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr497|Olfr498_chr7_108431136_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr43|Olfr404-ps1_chr11_74223012_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr43|Olfr404-ps1_chr11_74223012_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr401|Olfr402_chr11_74132718_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr401|Olfr402_chr11_74132718_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr368|Pdcl_chr2_37343499_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr368|Pdcl_chr2_37343499_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr337-ps1|Olfr338_chr2_36352785_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr337-ps1|Olfr338_chr2_36352785_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr31|Il3ra_chr14_14336915_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr31|Il3ra_chr14_14336915_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr273|Cct3-ps1_chr4_52890412_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr273|Cct3-ps1_chr4_52890412_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr268-ps1|Olfr1305_chr2_111863014_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr268-ps1|Olfr1305_chr2_111863014_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr194|Olfr195_chr16_59125223_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr194|Olfr195_chr16_59125223_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1362|Olfr11_chr13_21633128_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1362|Olfr11_chr13_21633128_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1177-ps|Olfr1178_chr2_88365385_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1177-ps|Olfr1178_chr2_88365385_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1167|Olfr1168_chr2_88175720_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1167|Olfr1168_chr2_88175720_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1154|Olfr1155_chr2_87937971_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1154|Olfr1155_chr2_87937971_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1054|Olfr1055_chr2_86343059_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1054|Olfr1055_chr2_86343059_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1008|Olfr1009_chr2_85698360_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Olfr1008|Olfr1009_chr2_85698360_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ocln|Marveld2_chr13_100592276_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ocln|Marveld2_chr13_100592276_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nyap2|Gm5530_chr1_81567489_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nyap2|Gm5530_chr1_81567489_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nuf2|Rgs5_chr1_169545566_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nuf2|Rgs5_chr1_169545566_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrp1|Gm26002_chr8_128556054_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrp1|Gm26002_chr8_128556054_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrg3|Gm10713_chr14_39735265_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrg3|Gm10713_chr14_39735265_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrcam|Stxbp6_chr12_44768462_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nrcam|Stxbp6_chr12_44768462_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nr3c2|Gm24838_chr8_77140207_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nr3c2|Gm24838_chr8_77140207_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Npy2r|Gm22038_chr3_82613607_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Npy2r|Gm22038_chr3_82613607_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Npbwr1|Rb1cc1_chr1_6169468_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Npbwr1|Rb1cc1_chr1_6169468_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ninj2|Gm25327_chr6_120130902_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ninj2|Gm25327_chr6_120130902_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nhs|5S_rRNA_chrX_162182501_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nhs|5S_rRNA_chrX_162182501_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nell1|Ano5_chr7_51421098_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nell1|Ano5_chr7_51421098_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Negr1|Gm15578_chr3_156802856_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Negr1|Gm15578_chr3_156802856_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nebl|Gm13323_chr2_17750751_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nebl|Gm13323_chr2_17750751_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncoa7|Hey2_chr10_30817757_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncoa7|Hey2_chr10_30817757_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncoa2|Tram1_chr1_13554356_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncoa2|Tram1_chr1_13554356_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nckap5|Mgat5_chr1_126941048_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Nckap5|Mgat5_chr1_126941048_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncam2|Gm23355_chr16_82241215_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ncam2|Gm23355_chr16_82241215_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myo1f|Zfp414_chr17_33621564_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myo1f|Zfp414_chr17_33621564_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myh9|Txn2_chr15_77898523_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myh9|Txn2_chr15_77898523_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myb|Gm2467_chr10_21213215_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Myb|Gm2467_chr10_21213215_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mybpc1|Spic_chr10_88654755_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mybpc1|Spic_chr10_88654755_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mut|Gm6771_chr17_40982426_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mut|Gm6771_chr17_40982426_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mup-ps18|Mup-ps19_chr4_61952904_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mup-ps18|Mup-ps19_chr4_61952904_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mucl1|Gm22852_chr15_103783966_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mucl1|Gm22852_chr15_103783966_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mtss1|Gm5045_chr15_59163382_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mtss1|Gm5045_chr15_59163382_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Msra|A930011O12Rik_chr14_64466652_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Msra|A930011O12Rik_chr14_64466652_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mmp27|Mmp20_chr9_7613153_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mmp27|Mmp20_chr9_7613153_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mki67|Gm9341_chr7_135730168_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mki67|Gm9341_chr7_135730168_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mir3072/Mirg|Dio3os_chr12_109905699_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mir3072/Mirg|Dio3os_chr12_109905699_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mir1899|Trpc6_chr9_8279871_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mir1899|Trpc6_chr9_8279871_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mib2|B930041F14Rik_chr4_155679938_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mib2|B930041F14Rik_chr4_155679938_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mfap3l|Gm23329_chr8_60689206_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mfap3l|Gm23329_chr8_60689206_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mesdc2|9930013L23Rik_chr7_83927028_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mesdc2|9930013L23Rik_chr7_83927028_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mctp2|Gm10294_chr7_72644819_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mctp2|Gm10294_chr7_72644819_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Marco|En1_chr1_120574172_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Marco|En1_chr1_120574172_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Map9|Npy2r_chr3_82484134_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Map9|Npy2r_chr3_82484134_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb5|Gm14782_chrX_91849065_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb5|Gm14782_chrX_91849065_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb5|Gm14782_chrX_91820772_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb5|Gm14782_chrX_91820772_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb18|Gm14777_chrX_92251622_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb18|Gm14777_chrX_92251622_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb16|Gm4772_chrX_79690432_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Mageb16|Gm4772_chrX_79690432_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Macc1|Gm25675_chr12_119594570_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Macc1|Gm25675_chr12_119594570_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lztfl1|Gm17020_chr9_123746027_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lztfl1|Gm17020_chr9_123746027_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ly96|Gm5828_chr1_16742002_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ly96|Gm5828_chr1_16742002_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrrc7|Gm9423_chr3_158877554_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrrc7|Gm9423_chr3_158877554_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrrc7|Gm9423_chr3_158631783_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrrc7|Gm9423_chr3_158631783_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrig2|Gm26091_chr3_104591564_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrig2|Gm26091_chr3_104591564_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrfn3|Tyrobp_chr7_30389086_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lrfn3|Tyrobp_chr7_30389086_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lix1|Lnpep_chr17_17476555_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lix1|Lnpep_chr17_17476555_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lelp1|Sprr2a1/Sprr2a2_chr3_92189220_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lelp1|Sprr2a1/Sprr2a2_chr3_92189220_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Large|Mir28b_chr8_72928287_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Large|Mir28b_chr8_72928287_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Large|Gm23255_chr8_73527464_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Large|Gm23255_chr8_73527464_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lama1|Arhgap28_chr17_67831851_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Lama1|Arhgap28_chr17_67831851_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Krtap6-2|Gm23655_chr16_89444851_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Krtap6-2|Gm23655_chr16_89444851_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klra5|Gm15854_chr6_129938960_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klra5|Gm15854_chr6_129938960_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klhl6|Klhl24_chr16_20039890_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klhl6|Klhl24_chr16_20039890_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klf3|Tlr1_chr5_64893132_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klf3|Tlr1_chr5_64893132_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klf14|Mir29a_chr6_30999962_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Klf14|Mir29a_chr6_30999962_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kdm4a|Ptprf_chr4_118186686_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kdm4a|Ptprf_chr4_118186686_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kdelr2|Daglb_chr5_143429274_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kdelr2|Daglb_chr5_143429274_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kctd1|Aqp4_chr18_15229278_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kctd1|Aqp4_chr18_15229278_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnt2|Gm4845_chr1_141039178_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnt2|Gm4845_chr1_141039178_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnt2|Gm4845_chr1_140820579_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnt2|Gm4845_chr1_140820579_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnk1|Slc35f3_chr8_126109251_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnk1|Slc35f3_chr8_126109251_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnk16|Nudt13_chr14_20283735_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnk16|Nudt13_chr14_20283735_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnj2|Gm11675_chr11_111218965_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnj2|Gm11675_chr11_111218965_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnj2|Gm11675_chr11_111186289_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnj2|Gm11675_chr11_111186289_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnh7|Gm23503_chr2_63298967_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kcnh7|Gm23503_chr2_63298967_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kalrn|Ropn1_chr16_34586147_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Kalrn|Ropn1_chr16_34586147_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Iyd|Plekhg1_chr10_3604249_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Iyd|Plekhg1_chr10_3604249_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Isl1|Gm23198_chr13_116581348_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Isl1|Gm23198_chr13_116581348_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ipmk|Gm22937_chr10_71695188_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ipmk|Gm22937_chr10_71695188_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Insr|A430078G23Rik_chr8_3342084_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Insr|A430078G23Rik_chr8_3342084_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Impad1|Gm11779_chr4_4886835_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Impad1|Gm11779_chr4_4886835_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Il1rapl2|Gm25393_chrX_137692684_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Il1rapl2|Gm25393_chrX_137692684_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Il1f9|Il1f6_chr2_24197041_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Il1f9|Il1f6_chr2_24197041_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ikzf2|Spag16_chr1_69701386_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ikzf2|Spag16_chr1_69701386_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igsf10|Gm5709_chr3_59374570_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igsf10|Gm5709_chr3_59374570_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igkv1-110|Igkv2-109_chr6_68286623_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igkv1-110|Igkv2-109_chr6_68286623_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ighv1-64|Ighv8-11_chr12_115562012_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ighv1-64|Ighv8-11_chr12_115562012_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igbp1b|Gm25434_chr6_139140197_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Igbp1b|Gm25434_chr6_139140197_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hsfy2|Satb2_chr1_56775967_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hsfy2|Satb2_chr1_56775967_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hs6st3|Oxgr1_chr14_119959483_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hs6st3|Oxgr1_chr14_119959483_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hs1bp3|Rhob_chr12_8405209_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hs1bp3|Rhob_chr12_8405209_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hpse|Helq_chr5_100743925_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hpse|Helq_chr5_100743925_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hnf4g|Rps24-ps2_chr3_3690504_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hnf4g|Rps24-ps2_chr3_3690504_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hmox2|Cdip1_chr16_4746705_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hmox2|Cdip1_chr16_4746705_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hist1h2al|S1pr3_chr13_51269080_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hist1h2al|S1pr3_chr13_51269080_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hist1h1e|Gm22452_chr13_23642270_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hist1h1e|Gm22452_chr13_23642270_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hhipl2|Gm8214_chr1_183567850_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hhipl2|Gm8214_chr1_183567850_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hgf|Gm8991_chr5_16670747_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hgf|Gm8991_chr5_16670747_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Helt|Acsl1_chr8_46348743_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Helt|Acsl1_chr8_46348743_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hdhd1a|Prr16_chr18_51075842_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hdhd1a|Prr16_chr18_51075842_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hamp2|Hamp_chr7_30930538_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Hamp2|Hamp_chr7_30930538_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_H2-Q3|Gm11131/H2-Q4_chr17_35371106_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_H2-Q3|Gm11131/H2-Q4_chr17_35371106_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gzmk|BC067074_chr13_113276738_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gzmk|BC067074_chr13_113276738_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Guca2a|Guca2b_chr4_119648973_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Guca2a|Guca2b_chr4_119648973_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gprin3|Gm22622_chr6_59694853_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gprin3|Gm22622_chr6_59694853_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gprin3|Gm22622_chr6_59588206_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gprin3|Gm22622_chr6_59588206_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr65|Kcnk10_chr12_98359013_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr65|Kcnk10_chr12_98359013_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr133|Sfswap_chr5_129439450_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr133|Sfswap_chr5_129439450_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr113|Ept1_chr5_30226328_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpr113|Ept1_chr5_30226328_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpm6a|Adam29_chr8_55548709_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpm6a|Adam29_chr8_55548709_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpbp1|Gm15290_chr13_111503245_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gpbp1|Gm15290_chr13_111503245_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gmds|Gm11381_chr13_32354332_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gmds|Gm11381_chr13_32354332_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9959|Gm9386_chr17_80857741_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9959|Gm9386_chr17_80857741_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9956|Gm24285_chr10_57141436_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9956|Gm24285_chr10_57141436_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9946|Gm7292_chr6_117588618_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9946|Gm7292_chr6_117588618_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9931|Gm22966_chr1_148276154_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9931|Gm22966_chr1_148276154_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26472404_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26472404_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26417762_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26417762_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26352485_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9884|Gm24064_chr1_26352485_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9800|Fhit_chr14_9048701_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9800|Fhit_chr14_9048701_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9795|Gm9956_chr10_56724516_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9795|Gm9956_chr10_56724516_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9789|Gm7735_chr16_89165282_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9789|Gm7735_chr16_89165282_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_94271850_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_94271850_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_94039828_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_94039828_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9621|Gm24200_chr9_93648185_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9621|Gm24200_chr9_93648185_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9578|Gm22891_chr14_81091682_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9578|Gm22891_chr14_81091682_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9578|Gm22891_chr14_80625861_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9578|Gm22891_chr14_80625861_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9427|Gm15256_chrX_4461811_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9427|Gm15256_chrX_4461811_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9423|Depdc1a_chr3_159229206_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9423|Depdc1a_chr3_159229206_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9312|Gm16372_chr12_24399255_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9312|Gm16372_chr12_24399255_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9308|Itgbl1_chr14_123728240_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9308|Itgbl1_chr14_123728240_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9257|Gm22189_chr12_19778289_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9257|Gm22189_chr12_19778289_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9135|Scgb2b12_chr7_32188363_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm9135|Scgb2b12_chr7_32188363_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8919|Gm8935_chr3_11735971_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8919|Gm8935_chr3_11735971_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8910|Gm22547_chr3_11127911_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8910|Gm22547_chr3_11127911_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8888|Slc38a4_chr15_96981382_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8888|Slc38a4_chr15_96981382_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8882|n-R5s166_chr6_132499261_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8882|n-R5s166_chr6_132499261_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8715|Gm15772_chr5_3182332_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8715|Gm15772_chr5_3182332_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8597|Rnu6_chr17_13415434_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8597|Rnu6_chr17_13415434_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8597|Rnu6_chr17_13411831_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8597|Rnu6_chr17_13411831_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8349|Arhgef26_chr3_61710879_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8349|Arhgef26_chr3_61710879_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8215|Gm5390_chrX_62081077_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8215|Gm5390_chrX_62081077_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8116|Col12a1_chr9_78826625_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm8116|Col12a1_chr9_78826625_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm807|Zfp366_chr13_99134129_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm807|Zfp366_chr13_99134129_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7954|Gm2878_chr14_41460919_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7954|Gm2878_chr14_41460919_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7931|Slit2_chr5_47969466_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7931|Slit2_chr5_47969466_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7931|Slit2_chr5_46944398_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7931|Slit2_chr5_46944398_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7916|Gm14598_chrX_54230579_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7916|Gm14598_chrX_54230579_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7719|Gm24377_chr12_59444158_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7719|Gm24377_chr12_59444158_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7579|Krtap5-5_chr7_142216937_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7579|Krtap5-5_chr7_142216937_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7488|Tbl1xr1_chr3_21688681_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7488|Tbl1xr1_chr3_21688681_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7367|A230006K03Rik_chr7_60766249_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7367|A230006K03Rik_chr7_60766249_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7290|Gm6471_chr7_142777803_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7290|Gm6471_chr7_142777803_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7258|Inpp5f_chr7_128608030_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7258|Inpp5f_chr7_128608030_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7237|Gm8975_chr19_33443094_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7237|Gm8975_chr19_33443094_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7191|Gm23494_chr8_98177640_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7191|Gm23494_chr8_98177640_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7146|Klhl4_chrX_114297737_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm7146|Klhl4_chrX_114297737_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6910|Gm10324_chr13_66016067_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6910|Gm10324_chr13_66016067_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6882|Vmn1r130_chr7_21499480_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6882|Vmn1r130_chr7_21499480_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6773|Nr1d2_chr14_18143014_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6773|Nr1d2_chr14_18143014_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6767|Cblb_chr16_51949225_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6767|Cblb_chr16_51949225_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6726|Gm20410_chr17_38539644_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6726|Gm20410_chr17_38539644_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6686|Chd1_chr17_15606164_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6686|Chd1_chr17_15606164_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6632|Gm22308_chr5_59122785_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6632|Gm22308_chr5_59122785_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6600|Gm8837_chr6_131060264_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6600|Gm8837_chr6_131060264_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6600|Gm8837_chr6_130958428_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6600|Gm8837_chr6_130958428_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6586|Gm10482_chr5_10074437_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6586|Gm10482_chr5_10074437_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6569/Mroh5|Gm7935_chr15_73876474_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6569/Mroh5|Gm7935_chr15_73876474_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm649|Gm14805_chrX_89304055_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm649|Gm14805_chrX_89304055_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6447|Gm15062_chrX_146038005_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6447|Gm15062_chrX_146038005_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6446|Gm15057_chrX_145934071_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6446|Gm15057_chrX_145934071_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6327|Ercc4_chr16_13103062_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6327|Ercc4_chr16_13103062_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6327|Ercc4_chr16_12978218_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6327|Ercc4_chr16_12978218_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6226|Ube3a_chr7_59207105_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6226|Ube3a_chr7_59207105_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6214|Pdha2_chr3_141151607_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6214|Pdha2_chr3_141151607_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6205|Gm3183_chr5_94801127_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6205|Gm3183_chr5_94801127_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6098|Zbbx_chr3_74837647_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6098|Zbbx_chr3_74837647_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6098|Zbbx_chr3_74594898_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6098|Zbbx_chr3_74594898_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6034|Gm11127_chr17_36052344_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6034|Gm11127_chr17_36052344_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6031|Ube2v2_chr16_15506563_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6031|Ube2v2_chr16_15506563_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6026|Sry_chrY_2608602_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm6026|Sry_chrY_2608602_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5974|Gm23240_chr1_48359510_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5974|Gm23240_chr1_48359510_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5965|Krtap14_chr16_88793962_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5965|Krtap14_chr16_88793962_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5944|Gm14903_chrX_115553707_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5944|Gm14903_chrX_115553707_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5899|Gm23884_chr7_94986817_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5899|Gm23884_chr7_94986817_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5891|Vmn1r137_chr7_21982288_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5891|Vmn1r137_chr7_21982288_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5849|4930529C04Rik_chr3_90993002_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5849|4930529C04Rik_chr3_90993002_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5839|Gm25440_chr18_48709211_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5839|Gm25440_chr18_48709211_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5803|Gm19840_chr15_22753371_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5803|Gm19840_chr15_22753371_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5797|Gm8374_chr14_7355812_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5797|Gm8374_chr14_7355812_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_101362527_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_101362527_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_100252056_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_100252056_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_100114233_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5742|Gm22223_chr8_100114233_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5732|Scgb1b21_chr7_33512507_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5732|Scgb1b21_chr7_33512507_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5529|Gm23934_chr1_79940816_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5529|Gm23934_chr1_79940816_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5426|Gm22913_chr10_96160562_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5426|Gm22913_chr10_96160562_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5386|Gm14652_chrX_45643492_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5386|Gm14652_chrX_45643492_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5381|Gm25552_chrX_13953093_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5381|Gm25552_chrX_13953093_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5335|A730056A06Rik_chr7_73178366_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5335|A730056A06Rik_chr7_73178366_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5319|Gm15926_chr7_4196305_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5319|Gm15926_chr7_4196305_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5083|Gm27007_chr13_44268133_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5083|Gm27007_chr13_44268133_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5046|Gm23907_chr15_65670406_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm5046|Gm23907_chr15_65670406_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4993|Gm22590_chrX_120980561_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4993|Gm22590_chrX_120980561_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4945|Trerf1_chr17_47081384_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4945|Trerf1_chr17_47081384_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_113289991_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_113289991_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_113022336_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_113022336_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_112631061_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4822|Tpm3-rs7_chr14_112631061_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4767|Zfp781_chr10_81832986_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4767|Zfp781_chr10_81832986_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm44|Gm14773_chrX_91124531_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm44|Gm14773_chrX_91124531_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4487|Gm24073_chr14_114509643_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4487|Gm24073_chr14_114509643_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4487|Gm24073_chr14_114206933_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4487|Gm24073_chr14_114206933_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4409/Lrrtm4|Lrrtm4_chr6_80653876_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4409/Lrrtm4|Lrrtm4_chr6_80653876_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4398|Scgb2b15_chr7_32811258_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4398|Scgb2b15_chr7_32811258_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4149|Gm23012_chr13_75678977_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm4149|Gm23012_chr13_75678977_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3944|Gm5784_chr12_19261558_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3944|Gm5784_chr12_19261558_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3833|Fhit_chr14_10182079_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3833|Fhit_chr14_10182079_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm382|Gm22139_chrX_127168806_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm382|Gm22139_chrX_127168806_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3409|Gm3415_chr5_146545298_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3409|Gm3415_chr5_146545298_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3015|Gm3025_chr14_42779352_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm3015|Gm3025_chr14_42779352_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2892|Gm2223_chrX_33498043_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2892|Gm2223_chrX_33498043_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2825|Spin2-ps6_chrX_33212720_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2825|Spin2-ps6_chrX_33212720_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2825|Spin2-ps6_chrX_33185627_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm2825|Spin2-ps6_chrX_33185627_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm27028/Mir30c-2|Ogfrl1_chr1_23303013_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm27028/Mir30c-2|Ogfrl1_chr1_23303013_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm27025|Gm25700_chr13_86716570_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm27025|Gm25700_chr13_86716570_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26950|Mrgprb8_chr7_48369618_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26950|Mrgprb8_chr7_48369618_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26933|Tnfrsf11b_chr15_54184170_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26933|Tnfrsf11b_chr15_54184170_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26915|Nrip1_chr16_76172902_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26915|Nrip1_chr16_76172902_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26901|Sntg1_chr1_8159933_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26901|Sntg1_chr1_8159933_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26901|Sntg1_chr1_7997491_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26901|Sntg1_chr1_7997491_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26861|Gm25496_chr13_10892494_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26861|Gm25496_chr13_10892494_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26815|Gm26747_chr8_121409170_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26815|Gm26747_chr8_121409170_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26799|Srgap3_chr6_112708167_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26799|Srgap3_chr6_112708167_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26786/Zfp90|6030452D12Rik_chr8_106490102_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26786/Zfp90|6030452D12Rik_chr8_106490102_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26786/Zfp90|6030452D12Rik_chr8_106483300_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26786/Zfp90|6030452D12Rik_chr8_106483300_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26782|Klhl33_chr14_50881536_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26782|Klhl33_chr14_50881536_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26766|Gm16136_chr15_37095418_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26766|Gm16136_chr15_37095418_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26729|Klhl25_chr7_75814293_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26729|Klhl25_chr7_75814293_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_52385395_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_52385395_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_52292854_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_52292854_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_51987375_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26651|Diras2_chr13_51987375_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26619/Gm10260|Arhgef28_chr13_97849957_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26619/Gm10260|Arhgef28_chr13_97849957_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26601|Dip2c_chr13_9435974_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26601|Dip2c_chr13_9435974_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26585|Slc2a12_chr10_22526528_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26585|Slc2a12_chr10_22526528_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26580/Kcnq5|Rims1_chr1_21998561_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26580/Kcnq5|Rims1_chr1_21998561_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26490|Gm12605_chr4_89188982_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26490|Gm12605_chr4_89188982_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26396|Gm13795_chr2_95068121_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26396|Gm13795_chr2_95068121_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26354|Gm7536_chr3_23177470_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26354|Gm7536_chr3_23177470_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26307|Gm26937_chr16_74775177_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26307|Gm26937_chr16_74775177_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26235|Gm25392_chr18_18980799_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26235|Gm25392_chr18_18980799_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26197|Akap11_chr14_78336706_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26197|Akap11_chr14_78336706_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26190|B3gat1_chr9_26704194_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26190|B3gat1_chr9_26704194_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26190|B3gat1_chr9_26099564_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26190|B3gat1_chr9_26099564_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26182|Gm14929_chrX_119679214_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26182|Gm14929_chrX_119679214_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26106|Gm7729_chr18_27001637_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26106|Gm7729_chr18_27001637_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26087|Gm12388_chr4_40057489_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26087|Gm12388_chr4_40057489_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26076|Gm25519_chr3_111601533_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm26076|Gm25519_chr3_111601533_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25985|Gm6404_chr13_115968946_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25985|Gm6404_chr13_115968946_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25985|Gm6404_chr13_115893051_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25985|Gm6404_chr13_115893051_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25959|Gm13468_chr2_47549581_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25959|Gm13468_chr2_47549581_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25935|Gm22593_chr17_94299657_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25935|Gm22593_chr17_94299657_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25914|Gm26290_chr9_20187017_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25914|Gm26290_chr9_20187017_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25851|Gm14646_chrX_58362404_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25851|Gm14646_chrX_58362404_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25830|4930555F03Rik_chr8_48987934_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25830|4930555F03Rik_chr8_48987934_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25824|Gm26977_chr18_79707342_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25824|Gm26977_chr18_79707342_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25817|Scgb2b17_chr7_33038155_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25817|Scgb2b17_chr7_33038155_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25813|Gm23666_chr8_52966777_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25813|Gm23666_chr8_52966777_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25778|Ppapdc1a_chr7_128987797_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25778|Ppapdc1a_chr7_128987797_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25769|Gm11487_chr4_73206000_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25769|Gm11487_chr4_73206000_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25761|Magi2_chr5_20187071_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25761|Magi2_chr5_20187071_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_87352241_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_87352241_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_87067194_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_87067194_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_86774665_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25700|Gm24935_chr13_86774665_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25661|Zfp868_chr8_69503570_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25661|Zfp868_chr8_69503570_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25634|Hs6st1_chr1_35792238_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25634|Hs6st1_chr1_35792238_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25608|Pgm1_chr5_64034837_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25608|Pgm1_chr5_64034837_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25602|Tbc1d32_chr10_55718849_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25602|Tbc1d32_chr10_55718849_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25578|Actr3_chr1_125320625_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25578|Actr3_chr1_125320625_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25537|Gm24122_chr1_101981469_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25537|Gm24122_chr1_101981469_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25497|Lrrn3_chr12_41367289_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25497|Lrrn3_chr12_41367289_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25496|Ryr2_chr13_11504823_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25496|Ryr2_chr13_11504823_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25495|Gm23225_chr14_90686498_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25495|Gm23225_chr14_90686498_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25485|Gm12460_chr4_51102034_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25485|Gm12460_chr4_51102034_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25462|Gm24495_chr7_59502750_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25462|Gm24495_chr7_59502750_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146400526_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146400526_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146285224_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146285224_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146124703_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25460|Gm5263_chr1_146124703_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25440|Dtwd2_chr18_49692619_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25440|Dtwd2_chr18_49692619_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25421|Gm15064_chrX_75583528_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25421|Gm15064_chrX_75583528_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25414|Gm26449_chr12_14597476_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25414|Gm26449_chr12_14597476_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25378|Gm11908_chr4_28415832_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25378|Gm11908_chr4_28415832_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25354|Obox3_chr7_15599638_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25354|Obox3_chr7_15599638_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25348|Gm24730_chr17_63129768_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25348|Gm24730_chr17_63129768_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25344|Tmem232_chr17_65158021_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25344|Tmem232_chr17_65158021_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25278|Csmd1_chr8_16900141_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25278|Csmd1_chr8_16900141_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25169|Efnb2_chr8_8318625_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25169|Efnb2_chr8_8318625_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25115|Diap3_chr14_86594277_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25115|Diap3_chr14_86594277_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25099|Gm23143_chr4_117195868_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25099|Gm23143_chr4_117195868_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25061|Gm5403_chrX_127960869_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25061|Gm5403_chrX_127960869_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25061|Gm5403_chrX_127939192_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25061|Gm5403_chrX_127939192_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25051|Gm1818_chr12_48535960_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm25051|Gm1818_chr12_48535960_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24935|Gm21232_chr13_87560063_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24935|Gm21232_chr13_87560063_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24925|Gm6767_chr16_51090911_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24925|Gm6767_chr16_51090911_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24880|Gm10172_chr7_70761693_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24880|Gm10172_chr7_70761693_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24864|Bckdhb_chr9_83946460_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24864|Bckdhb_chr9_83946460_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24863|Gm24635_chr13_79567295_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24863|Gm24635_chr13_79567295_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24839|Tmem132c_chr5_126592338_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24839|Tmem132c_chr5_126592338_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24790|Klf6_chr13_5281810_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24790|Klf6_chr13_5281810_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24773|Ncam2_chr16_81075638_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24773|Ncam2_chr16_81075638_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24773|Ncam2_chr16_80763190_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24773|Ncam2_chr16_80763190_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24720|Tshz1_chr18_83704440_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24720|Tshz1_chr18_83704440_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24691|Grm8_chr6_27120934_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24691|Grm8_chr6_27120934_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24687|Rpl7a-ps12_chrX_152898428_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24687|Rpl7a-ps12_chrX_152898428_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24680|4921530L21Rik_chr14_95564815_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24680|4921530L21Rik_chr14_95564815_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24633|Gm25568_chr1_19626210_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24633|Gm25568_chr1_19626210_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24617|Mospd4_chr18_46440554_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24617|Mospd4_chr18_46440554_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24587|Dcn_chr10_97325768_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24587|Dcn_chr10_97325768_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24534|Gm13255_chr2_8532231_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24534|Gm13255_chr2_8532231_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24471|Cartpt_chr13_99819613_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24471|Cartpt_chr13_99819613_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24404|Nrg3_chr14_37622843_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24404|Nrg3_chr14_37622843_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24398|Xpo1_chr11_23221902_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24398|Xpo1_chr11_23221902_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24387|Foxp1_chr6_98820733_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24387|Foxp1_chr6_98820733_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24382|Mbnl1_chr3_60493171_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24382|Mbnl1_chr3_60493171_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24369|n-R5s50_chr14_110083442_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24369|n-R5s50_chr14_110083442_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24369|n-R5s50_chr14_110058858_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24369|n-R5s50_chr14_110058858_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24319|Psat1_chr19_15843191_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24319|Psat1_chr19_15843191_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24295|Mef2c_chr13_83422776_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24295|Mef2c_chr13_83422776_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24288|Gm17215_chr8_6985813_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24288|Gm17215_chr8_6985813_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24288|Gm17215_chr8_6496685_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24288|Gm17215_chr8_6496685_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_29018077_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_29018077_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_28963606_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_28963606_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_28442741_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24246|Pik3c3_chr18_28442741_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24244|Gm15405_chr17_91833301_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24244|Gm15405_chr17_91833301_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24212|Tox3_chr8_90091614_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24212|Tox3_chr8_90091614_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24212|Tox3_chr8_89921353_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24212|Tox3_chr8_89921353_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24187|Chrm3_chr13_9856059_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24187|Chrm3_chr13_9856059_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24168|Gm23790_chr10_31092441_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24168|Gm23790_chr10_31092441_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24153|Gm26365_chr7_59689410_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24153|Gm26365_chr7_59689410_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24129|Tecrl_chr5_83024969_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24129|Tecrl_chr5_83024969_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24129|Tecrl_chr5_82879257_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24129|Tecrl_chr5_82879257_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24117|Gm25391_chr4_62867203_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24117|Gm25391_chr4_62867203_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24104|Gm26058_chr6_10713426_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24104|Gm26058_chr6_10713426_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24104|Gm26058_chr6_10691471_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24104|Gm26058_chr6_10691471_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24042|Gm11898_chr4_25850129_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24042|Gm11898_chr4_25850129_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24039|4930461C15Rik_chr16_58339094_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm24039|4930461C15Rik_chr16_58339094_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23987|Fam135b_chr15_71233766_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23987|Fam135b_chr15_71233766_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_51926452_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_51926452_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_50998534_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_50998534_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_50601042_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23986|Gm24929_chr8_50601042_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23985|Gm4915_chrX_113912243_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23985|Gm4915_chrX_113912243_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23968|Top1_chr2_160635117_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23968|Top1_chr2_160635117_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23965|Gm23537_chr1_104292891_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23965|Gm23537_chr1_104292891_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23913|Gm10480_chr12_17963588_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23913|Gm10480_chr12_17963588_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23911|Gm26288_chr7_58121463_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23911|Gm26288_chr7_58121463_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23903|Ank_chr15_27386323_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23903|Ank_chr15_27386323_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23903|Ank_chr15_27289471_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23903|Ank_chr15_27289471_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23900|Zfp804a_chr2_81792003_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23900|Zfp804a_chr2_81792003_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23896|Gm24902_chr5_57021462_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23896|Gm24902_chr5_57021462_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23860|Gm11800_chr4_7833987_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23860|Gm11800_chr4_7833987_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23848|Trps1_chr15_50629045_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23848|Trps1_chr15_50629045_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23838|Gm25233_chr5_6187994_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23838|Gm25233_chr5_6187994_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23835|Fam84b/9930014A18Rik_chr15_60804888_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23835|Fam84b/9930014A18Rik_chr15_60804888_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23829|Gm5974_chr1_48090950_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23829|Gm5974_chr1_48090950_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23793|Gm26445/Gm20746_chr10_130562349_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23793|Gm26445/Gm20746_chr10_130562349_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124682259_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124682259_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124607596_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124607596_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124580090_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23777|Slc16a7_chr10_124580090_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23752|Gm24815_chr12_6806813_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23752|Gm24815_chr12_6806813_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23752|Gm24815_chr12_6520322_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23752|Gm24815_chr12_6520322_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23714|Gm20622_chr7_15706848_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23714|Gm20622_chr7_15706848_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23708|G6pd2_chr5_60807005_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23708|G6pd2_chr5_60807005_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23674|Gm26106_chr18_26833040_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23674|Gm26106_chr18_26833040_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23665|Csmd3_chr15_47360382_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23665|Csmd3_chr15_47360382_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23648|Gm5874_chr6_18759515_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23648|Gm5874_chr6_18759515_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23644|Gm15442_chr3_77601187_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23644|Gm15442_chr3_77601187_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23503|Fign_chr2_63841953_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23503|Fign_chr2_63841953_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23452|Gm23900_chr2_81463771_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23452|Gm23900_chr2_81463771_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23447|Gm23773_chr17_61024180_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23447|Gm23773_chr17_61024180_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23437|Gm24818_chr14_108171437_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23437|Gm24818_chr14_108171437_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23375|Kap_chr6_133823993_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23375|Kap_chr6_133823993_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23355|Gm21833_chr16_82637443_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23355|Gm21833_chr16_82637443_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23355|Gm21833_chr16_82587280_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23355|Gm21833_chr16_82587280_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23329|2700029M09Rik_chr8_60821216_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23329|2700029M09Rik_chr8_60821216_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23321|Gp2_chr7_119416036_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23321|Gp2_chr7_119416036_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23229|Syt17_chr7_118289555_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23229|Syt17_chr7_118289555_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23216|Gm23974_chr1_45736015_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23216|Gm23974_chr1_45736015_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23203|Gm23447_chr17_60308169_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23203|Gm23447_chr17_60308169_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23131|Lphn2_chr3_148753906_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23131|Lphn2_chr3_148753906_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23097|Dync2h1_chr9_6783667_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23097|Dync2h1_chr9_6783667_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23092|Btc_chr5_91230138_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23092|Btc_chr5_91230138_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23083|Gm24773_chr16_80306335_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23083|Gm24773_chr16_80306335_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23083|Gm24773_chr16_80291586_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23083|Gm24773_chr16_80291586_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23072|Gm13469_chr2_46384964_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23072|Gm13469_chr2_46384964_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23038|4930570G19Rik_chr3_156258914_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23038|4930570G19Rik_chr3_156258914_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23022|Rab28_chr5_41398608_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23022|Rab28_chr5_41398608_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23022|Rab28_chr5_40474691_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23022|Rab28_chr5_40474691_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23021|8430419K02Rik_chr11_18809775_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23021|8430419K02Rik_chr11_18809775_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23013|Ppp1r3a_chr6_14463739_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23013|Ppp1r3a_chr6_14463739_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23003|Gm26369_chr16_55677721_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm23003|Gm26369_chr16_55677721_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22966|Gm15443_chr1_148487364_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22966|Gm15443_chr1_148487364_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22966|Gm15443_chr1_148460058_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22966|Gm15443_chr1_148460058_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104839339_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104839339_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104822810_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104822810_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104559122_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22945|Gm25522_chr10_104559122_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22944|RP23-442I7.1_chr3_4721637_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22944|RP23-442I7.1_chr3_4721637_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22939|Cntnap2_chr6_44695047_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22939|Cntnap2_chr6_44695047_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22913|Gm20091_chr10_96195849_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22913|Gm20091_chr10_96195849_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22866|Gm5620_chr9_90860665_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22866|Gm5620_chr9_90860665_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22864|Gm11255_chr4_75306436_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22864|Gm11255_chr4_75306436_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22797|Robo1_chr16_71788884_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22797|Robo1_chr16_71788884_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22789|Gm12003/Gm22801_chr11_12799378_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22789|Gm12003/Gm22801_chr11_12799378_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22782|Rpl10l_chr12_65804547_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22782|Rpl10l_chr12_65804547_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22782|Rpl10l_chr12_65637059_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22782|Rpl10l_chr12_65637059_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22764|Gm4822_chr14_112336119_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22764|Gm4822_chr14_112336119_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22702|Gm11499_chr11_92102843_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22702|Gm11499_chr11_92102843_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22689|Gm9742_chr13_7952460_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22689|Gm9742_chr13_7952460_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22673|Gm23059_chr12_60710214_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22673|Gm23059_chr12_60710214_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22618|Gm22976_chr5_51004178_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22618|Gm22976_chr5_51004178_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22597|Gm24514_chr18_55313123_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22597|Gm24514_chr18_55313123_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22594|1110002J07Rik_chr10_66725779_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22594|1110002J07Rik_chr10_66725779_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22548|Gm15669_chr1_67754744_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22548|Gm15669_chr1_67754744_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22546|Gm22194_chr10_11698047_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22546|Gm22194_chr10_11698047_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22536|Gm6632_chr5_59006954_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22536|Gm6632_chr5_59006954_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22530|Gcfc2_chr6_81857696_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22530|Gcfc2_chr6_81857696_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22507|Trhde_chr10_113726018_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22507|Trhde_chr10_113726018_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22469|Gm23909_chr14_37232498_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22469|Gm23909_chr14_37232498_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22463|Npbwr1_chr1_5807657_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22463|Npbwr1_chr1_5807657_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22459|Gm25041_chr16_53573320_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22459|Gm25041_chr16_53573320_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22444|mmu-mir-6238_chr7_53679364_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22444|mmu-mir-6238_chr7_53679364_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_109617169_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_109617169_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_109131997_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_109131997_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_108412181_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22438|Gm22159_chr1_108412181_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22331|Gm24937_chr1_113019844_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22331|Gm24937_chr1_113019844_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22331|Gm24937_chr1_112933246_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22331|Gm24937_chr1_112933246_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22324|Spock3_chr8_62808997_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22324|Spock3_chr8_62808997_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22256|Zfp934_chr13_62476339_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22256|Zfp934_chr13_62476339_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22223|Gm22715_chr8_102008218_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22223|Gm22715_chr8_102008218_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22219|Mc4r_chr18_66752035_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22219|Mc4r_chr18_66752035_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22217|Gm22448_chr16_66245315_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22217|Gm22448_chr16_66245315_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22196|Steap4_chr5_7941351_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22196|Steap4_chr5_7941351_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22141|Gm10080_chr9_44368658_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22141|Gm10080_chr9_44368658_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22097|Gm23041_chr10_109318535_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22097|Gm23041_chr10_109318535_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22034|Gm23965_chr1_103208498_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22034|Gm23965_chr1_103208498_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22034|Gm23965_chr1_103035432_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22034|Gm23965_chr1_103035432_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22016|Cdc73_chr1_142588206_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22016|Cdc73_chr1_142588206_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22016|Cdc73_chr1_142359388_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm22016|Cdc73_chr1_142359388_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21916|Gm21756_chrY_33210192_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21916|Gm21756_chrY_33210192_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21879|Gm20856_chrY_85092011_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21879|Gm20856_chrY_85092011_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21861|Gm21758_chrY_59348142_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21861|Gm21758_chrY_59348142_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21833|Rpl21-ps5_chr16_83364546_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21833|Rpl21-ps5_chr16_83364546_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21824|Gm21879_chrY_84712780_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21824|Gm21879_chrY_84712780_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21820|AC132591.1_chrY_5505868_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21820|AC132591.1_chrY_5505868_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21805|Gm21241_chrY_43220184_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21805|Gm21241_chrY_43220184_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21792|Gm21287_chrY_88462315_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21792|Gm21287_chrY_88462315_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21780|Gm21737_chrY_31336997_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21780|Gm21737_chrY_31336997_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21779|Gm21247_chrY_46434116_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21779|Gm21247_chrY_46434116_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21779|Gm21247_chrY_46183553_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21779|Gm21247_chrY_46183553_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42511970_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42511970_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42373895_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42373895_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42236423_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21774|Gm21805_chrY_42236423_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21767|Gm20822_chrY_15356556_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21767|Gm20822_chrY_15356556_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21767|Gm20822_chrY_15108314_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21767|Gm20822_chrY_15108314_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21763|AC201846.1_chrY_20069077_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21763|AC201846.1_chrY_20069077_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21763|AC201846.1_chrY_19820917_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21763|AC201846.1_chrY_19820917_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21762|Gm21731_chr13_120228406_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21762|Gm21731_chr13_120228406_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21720|Gm21838_chrY_89128823_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21720|Gm21838_chrY_89128823_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21719|Gm20830_chrY_6764604_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21719|Gm20830_chrY_6764604_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21693|Gm21704_chrY_3339248_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21693|Gm21704_chrY_3339248_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21645|Gm2799_chrX_32144132_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21645|Gm2799_chrX_32144132_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21614|Gm23249_chr12_93513337_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21614|Gm23249_chr12_93513337_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21573|Gm20803_chrY_61597911_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21573|Gm20803_chrY_61597911_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21281|Gm21308_chrY_48807654_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21281|Gm21308_chrY_48807654_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21163|Gm21180_chrY_76712891_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm21163|Gm21180_chrY_76712891_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20901|Gm21865_chrY_40153200_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20901|Gm21865_chrY_40153200_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20825|Gm20815_chrY_8154419_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20825|Gm20815_chrY_8154419_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20816|Gm20818_chrY_68881447_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20816|Gm20818_chrY_68881447_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20677|Ube2e2_chr14_18862824_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20677|Ube2e2_chr14_18862824_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20594|Gm4409_chr6_79902353_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20594|Gm4409_chr6_79902353_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20345|Vmn2r46_chr7_9751668_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm20345|Vmn2r46_chr7_9751668_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm1818|Gm26454_chr12_48998569_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm1818|Gm26454_chr12_48998569_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm17686|Ighv1-14_chr12_114637203_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm17686|Ighv1-14_chr12_114637203_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm17538|Gm5229_chr17_77778170_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm17538|Gm5229_chr17_77778170_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16501|Rbmy/Gm10256_chrY_2780901_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16501|Rbmy/Gm10256_chrY_2780901_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16465|Gm5071_chrX_91898120_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16465|Gm5071_chrX_91898120_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16432|Desi2_chr1_178177873_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16432|Desi2_chr1_178177873_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16432|Desi2_chr1_178061820_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16432|Desi2_chr1_178061820_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16391|Gm17538_chr17_76516456_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16391|Gm17538_chr17_76516456_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16363|Gm14406_chr2_177550000_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16363|Gm14406_chr2_177550000_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16223|Cpeb2/Gm7854_chr5_42834731_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16223|Cpeb2/Gm7854_chr5_42834731_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16223|Cpeb2/Gm7854_chr5_42282400_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm16223|Cpeb2/Gm7854_chr5_42282400_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15930|Gm15925_chr7_3767357_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15930|Gm15925_chr7_3767357_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15877|2900092C05Rik_chr7_12545987_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15877|2900092C05Rik_chr7_12545987_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15762|B230104C08Rik_chr6_147904905_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15762|B230104C08Rik_chr6_147904905_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15663|Mettl25_chr10_105675969_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15663|Mettl25_chr10_105675969_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15616|Gabrb1_chr5_72073007_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15616|Gabrb1_chr5_72073007_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15494|Eps8l1_chr7_4458757_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15494|Eps8l1_chr7_4458757_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149585325_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149585325_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149517610_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149517610_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149509610_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149509610_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149397022_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15443|Gm23535_chr1_149397022_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15405|Gm27039_chr17_92298326_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15405|Gm27039_chr17_92298326_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15387|Bai1_chr15_74364075_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15387|Bai1_chr15_74364075_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15315|Defa-ps9_chr8_21674305_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15315|Defa-ps9_chr8_21674305_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15195|Gm15192_chrX_160289439_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15195|Gm15192_chrX_160289439_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15173|Gm23381_chrX_157622506_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15173|Gm23381_chrX_157622506_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15168|Gm5764_chrX_158680745_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm15168|Gm5764_chrX_158680745_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14932|Gm23277_chrX_121553427_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14932|Gm23277_chrX_121553427_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14932|Gm23277_chrX_121442402_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14932|Gm23277_chrX_121442402_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14910|Tgif2lx2_chrX_118409812_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14910|Tgif2lx2_chrX_118409812_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14802|Ar_chrX_98107836_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14802|Ar_chrX_98107836_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14751|Rps24-ps3_chrX_79147000_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14751|Rps24-ps3_chrX_79147000_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14747|Fam47c_chrX_78712563_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14747|Fam47c_chrX_78712563_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14672|Gm14668_chrX_65710662_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14672|Gm14668_chrX_65710662_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14649|Gm14647_chrX_58216368_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14649|Gm14647_chrX_58216368_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14616|Gm14444_chr2_174987767_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14616|Gm14444_chr2_174987767_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14614|Gm14613_chrX_41724428_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14614|Gm14613_chrX_41724428_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14527|Gm3657_chrX_29676312_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14527|Gm3657_chrX_29676312_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14521|Gm14635_chrX_12235168_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14521|Gm14635_chrX_12235168_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14416|Gm14413_chr2_177160403_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14416|Gm14413_chr2_177160403_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14406|Gm14324_chr2_177607794_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14406|Gm14324_chr2_177607794_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14400|Gm14409_chr2_177239805_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14400|Gm14409_chr2_177239805_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14365|Gm9428_chrX_5199860_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14365|Gm9428_chrX_5199860_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14353|Gm14360_chrX_3463614_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14353|Gm14360_chrX_3463614_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14345|Gm14351_chrX_3707484_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14345|Gm14351_chrX_3707484_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14313|Mup9_chr4_60410887_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14313|Mup9_chr4_60410887_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14241|Gm11449_chr2_161372724_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14241|Gm11449_chr2_161372724_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14062|Btbd3_chr2_138036931_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm14062|Btbd3_chr2_138036931_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13994|Slc24a5_chr2_124802705_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13994|Slc24a5_chr2_124802705_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13810|B230118H07Rik_chr2_101150094_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13810|B230118H07Rik_chr2_101150094_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13801|Lrrc4c_chr2_96194698_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13801|Lrrc4c_chr2_96194698_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13750|Gm25748_chr1_64386867_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13750|Gm25748_chr1_64386867_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13750|Gm25748_chr1_64181496_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13750|Gm25748_chr1_64181496_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13710|Ctnnd1_chr2_84568773_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13710|Ctnnd1_chr2_84568773_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13685|Zc3h15_chr2_83584076_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13685|Zc3h15_chr2_83584076_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13678|Fsip2_chr2_82677555_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13678|Fsip2_chr2_82677555_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13517|Gm13615_chr2_55870505_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13517|Gm13615_chr2_55870505_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13484|Gm13498_chr2_50683378_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13484|Gm13498_chr2_50683378_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13481|Gm13489_chr2_48486812_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13481|Gm13489_chr2_48486812_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13470|Gm25264_chr2_46577669_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13470|Gm25264_chr2_46577669_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13458|Gm13455_chr2_40238835_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13458|Gm13455_chr2_40238835_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13452|Gm13453_chr2_39781870_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13452|Gm13453_chr2_39781870_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13447|Gm13446_chr2_35523256_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13447|Gm13446_chr2_35523256_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13392|Hnmt_chr2_23922265_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13392|Hnmt_chr2_23922265_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13377|Gm13376_chr2_21078678_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13377|Gm13376_chr2_21078678_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13163|C230088H06Rik_chr4_147206422_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13163|C230088H06Rik_chr4_147206422_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13101|Pramef17_chr4_143987344_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13101|Pramef17_chr4_143987344_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13083|Gm13088_chr4_143648722_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm13083|Gm13088_chr4_143648722_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12|Gm12355_chr11_98617047_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12|Gm12355_chr11_98617047_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12939|Sfpq_chr4_127012347_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12939|Sfpq_chr4_127012347_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12919|2610301B20Rik_chr4_10868092_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12919|2610301B20Rik_chr4_10868092_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12897|Gm12893_chr4_122214314_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12897|Gm12893_chr4_122214314_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12722|Gm12723_chr4_105441822_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12722|Gm12723_chr4_105441822_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12639|Gm12641_chr4_93000990_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12639|Gm12641_chr4_93000990_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12573|Mup19_chr4_61771185_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12573|Mup19_chr4_61771185_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12461|C630028M04Rik_chr4_51896668_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12461|C630028M04Rik_chr4_51896668_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12387|Gm26087_chr4_39956239_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12387|Gm26087_chr4_39956239_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12381|Gm25581_chr4_38909644_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12381|Gm25581_chr4_38909644_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12381|Gm25581_chr4_38873873_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12381|Gm25581_chr4_38873873_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12367|Gm12368_chr4_35381133_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12367|Gm12368_chr4_35381133_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12350|Akirin2_chr4_34538452_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12350|Akirin2_chr4_34538452_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12350|Akirin2_chr4_34503801_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12350|Akirin2_chr4_34503801_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12298|9130409J20Rik_chr11_66950562_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12298|9130409J20Rik_chr11_66950562_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12295|Gm26128_chr11_65455103_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12295|Gm26128_chr11_65455103_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12291|Gm12292_chr11_64794039_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12291|Gm12292_chr11_64794039_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12271|Rnf112_chr11_61424221_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12271|Rnf112_chr11_61424221_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12129|Gm12130_chr11_38485282_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12129|Gm12130_chr11_38485282_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12084|Pnpt1_chr11_29126447_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12084|Pnpt1_chr11_29126447_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12080|Gm6685_chr11_28101079_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12080|Gm6685_chr11_28101079_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12079|Gm12080_chr11_27953288_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12079|Gm12080_chr11_27953288_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12009|Gm24707_chr11_15231476_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12009|Gm24707_chr11_15231476_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12003/Gm22801|Gm12004_chr11_12957336_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm12003/Gm22801|Gm12004_chr11_12957336_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11997|Vwc2_chr11_10764096_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11997|Vwc2_chr11_10764096_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11986|U7_chr11_7579003_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11986|U7_chr11_7579003_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11925|Gm11924_chr4_30231988_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11925|Gm11924_chr4_30231988_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11923|Gm11925_chr4_29714037_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11923|Gm11925_chr4_29714037_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11871|Gm22817_chr4_21077710_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11871|Gm22817_chr4_21077710_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11853|Gm11867_chr4_18477628_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11853|Gm11867_chr4_18477628_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11835|Gm11814_chr4_10006099_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11835|Gm11814_chr4_10006099_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11780|Gm26436_chr4_4655918_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11780|Gm26436_chr4_4655918_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11779|Gm11782_chr4_5187939_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11779|Gm11782_chr4_5187939_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11746|Slc24a3_chr2_145121736_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11746|Slc24a3_chr2_145121736_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11733|Gm11734_chr11_117503141_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11733|Gm11734_chr11_117503141_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11704|2310067B10Rik_chr11_115758219_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11704|2310067B10Rik_chr11_115758219_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11473|B4galt5_chr2_167286494_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11473|B4galt5_chr2_167286494_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11461|Gm11462_chr2_165930289_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11461|Gm11462_chr2_165930289_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11397|Serpinb9g_chr13_33441421_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11397|Serpinb9g_chr13_33441421_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11382|Serpinb6b_chr13_32950902_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11382|Serpinb6b_chr13_32950902_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11263|Gm11409_chr4_79564188_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11263|Gm11409_chr4_79564188_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11260|Gm11261_chr4_78514037_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11260|Gm11261_chr4_78514037_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11259|Gm11256_chr4_75620169_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11259|Gm11256_chr4_75620169_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11258|Gm11253_chr4_74930529_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11258|Gm11253_chr4_74930529_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11247|Tyrp1_chr4_80806427_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11247|Tyrp1_chr4_80806427_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11077|Pde3a_chr6_140987538_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm11077|Pde3a_chr6_140987538_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10800|Gm13809_chr2_99548668_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10800|Gm13809_chr2_99548668_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10800|Gm13809_chr2_98799982_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10800|Gm13809_chr2_98799982_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10778|Gm8112_chr10_81673858_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10778|Gm8112_chr10_81673858_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10772|Gm26754_chr13_66232994_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10772|Gm26754_chr13_66232994_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10634|Trim43c_chr9_88825140_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10634|Trim43c_chr9_88825140_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10542|Npy6r_chr18_44261647_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10542|Npy6r_chr18_44261647_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10480|5730507C01Rik_chr12_18278406_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10480|5730507C01Rik_chr12_18278406_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10256|Gm10352_chrY_2877736_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10256|Gm10352_chrY_2877736_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10254|Sertm1_chr3_54852990_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10254|Sertm1_chr3_54852990_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10247|Grin2a_chr16_9067008_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10247|Grin2a_chr16_9067008_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10184|Nrxn1_chr17_89939327_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10184|Nrxn1_chr17_89939327_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10110|Gm25495_chr14_90298508_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10110|Gm25495_chr14_90298508_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10051|Gm15627_chr5_133952805_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gm10051|Gm15627_chr5_133952805_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glt1d1|Tmem132d_chr5_127746302_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glt1d1|Tmem132d_chr5_127746302_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glrx3|Gm25798_chr7_137896424_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glrx3|Gm25798_chr7_137896424_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glrx3|Gm25798_chr7_137643614_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glrx3|Gm25798_chr7_137643614_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glra3|Hpgd_chr8_56178168_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glra3|Hpgd_chr8_56178168_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glis1|Dmrtb1_chr4_107664533_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glis1|Dmrtb1_chr4_107664533_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glcci1/Gm16039/Gm16042|Ica1_chr6_8611916_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Glcci1/Gm16039/Gm16042|Ica1_chr6_8611916_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gkn3|Bmp10_chr6_87405412_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gkn3|Bmp10_chr6_87405412_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gigyf2|3110079O15Rik_chr1_87463924_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gigyf2|3110079O15Rik_chr1_87463924_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gbe1|Gm24968_chr16_70635874_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gbe1|Gm24968_chr16_70635874_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gata6|Rbbp8_chr18_11627974_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gata6|Rbbp8_chr18_11627974_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gas1|Gm5084_chr13_60200013_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gas1|Gm5084_chr13_60200013_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm9071_chr12_3006153_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm9071_chr12_3006153_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm7792_chr5_JH584298_random_17854_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm7792_chr5_JH584298_random_17854_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm25431_chr19_3034854_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm25431_chr19_3034854_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm23215_chr16_3044859_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Gap|Gm23215_chr16_3044859_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_G630016G05Rik|Gm13991_chr2_116492234_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_G630016G05Rik|Gm13991_chr2_116492234_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ftmt|Srfbp1_chr18_52391711_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ftmt|Srfbp1_chr18_52391711_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Frk|Gm26341_chr10_34745143_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Frk|Gm26341_chr10_34745143_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgfr1op|Ccr6_chr17_8219801_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgfr1op|Ccr6_chr17_8219801_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgf14|Gap_chr14_124688374_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgf14|Gap_chr14_124688374_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgf10|Nnt_chr13_119131625_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fgf10|Nnt_chr13_119131625_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fez2|Gm10093_chr17_78472586_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fez2|Gm10093_chr17_78472586_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxw4|Fgf8_chr19_45702897_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxw4|Fgf8_chr19_45702897_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxl17|A930002H24Rik_chr17_63765459_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxl17|A930002H24Rik_chr17_63765459_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxl17|A930002H24Rik_chr17_63745586_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fbxl17|A930002H24Rik_chr17_63745586_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam98a|Gm24126_chr17_75900771_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam98a|Gm24126_chr17_75900771_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam92b|A330074K22Rik_chr8_120195910_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam92b|A330074K22Rik_chr8_120195910_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam179b|Prpf39_chr12_65030489_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam179b|Prpf39_chr12_65030489_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam150a|St18_chr1_6433685_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Fam150a|St18_chr1_6433685_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ext2|Accs_chr2_93828096_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ext2|Accs_chr2_93828096_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Erbb2ip|Nln_chr13_103933893_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Erbb2ip|Nln_chr13_103933893_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epha5|Gm24626_chr5_85480398_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epha5|Gm24626_chr5_85480398_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epha5|Gm24626_chr5_85077799_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epha5|Gm24626_chr5_85077799_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epb4.1l3|Zbtb14_chr17_69334091_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Epb4.1l3|Zbtb14_chr17_69334091_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Emb|Gm6421_chr13_117299629_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Emb|Gm6421_chr13_117299629_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ehd3|Xdh_chr17_73859450_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ehd3|Xdh_chr17_73859450_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Eftud1|4933406J10Rik_chr7_82740451_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Eftud1|4933406J10Rik_chr7_82740451_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ednrb|RP24-312G4.2_chr14_104108145_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ednrb|RP24-312G4.2_chr14_104108145_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Edem1|Gm20387_chr6_109709589_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Edem1|Gm20387_chr6_109709589_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ear11|Gm21718_chr14_51301629_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ear11|Gm21718_chr14_51301629_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_E330017A01Rik|Cpox_chr16_58653618_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_E330017A01Rik|Cpox_chr16_58653618_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dusp6|B530045E10Rik_chr10_99342894_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dusp6|B530045E10Rik_chr10_99342894_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dtnbp1|Gm23104_chr13_45014895_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dtnbp1|Gm23104_chr13_45014895_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dsel|Gm22331_chr1_112267659_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dsel|Gm22331_chr1_112267659_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dock6|Rab3d_chr9_21882924_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dock6|Rab3d_chr9_21882924_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dock5|Nefm/Nefl_chr14_68010154_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dock5|Nefm/Nefl_chr14_68010154_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dmap1|Gm12840_chr4_117692754_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dmap1|Gm12840_chr4_117692754_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dld|Slc26a3_chr12_31361468_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dld|Slc26a3_chr12_31361468_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dgkh|Vwa8_chr14_78787937_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dgkh|Vwa8_chr14_78787937_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ddr2|Uap1_chr1_170119553_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ddr2|Uap1_chr1_170119553_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dctd|Tenm3_chr8_48192230_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dctd|Tenm3_chr8_48192230_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dcaf13|Gm9522_chr15_39174945_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Dcaf13|Gm9522_chr15_39174945_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D930048N14Rik|0610009B22Rik_chr11_51668346_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D930048N14Rik|0610009B22Rik_chr11_51668346_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D630045J12Rik|Zc3hav1l_chr6_38279744_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D630045J12Rik|Zc3hav1l_chr6_38279744_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D630032N06Rik|Gm22587_chr11_85288889_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D630032N06Rik|Gm22587_chr11_85288889_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Ertd751e|Gm25714_chr3_43857639_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Ertd751e|Gm25714_chr3_43857639_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Ertd751e|Gm25714_chr3_42823559_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Ertd751e|Gm25714_chr3_42823559_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Bwg0562e|4833424O15Rik_chr3_117382914_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D3Bwg0562e|4833424O15Rik_chr3_117382914_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D130017N08Rik|Eif2ak1_chr5_143791173_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D130017N08Rik|Eif2ak1_chr5_143791173_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D10Wsu102e|Aldh1l2_chr10_83469184_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_D10Wsu102e|Aldh1l2_chr10_83469184_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2d12|AC118710.1_chr15_82594092_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2d12|AC118710.1_chr15_82594092_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2c39|Cyp2c67_chr19_39603234_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2c39|Cyp2c67_chr19_39603234_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2c29|Cyp2c38_chr19_39384505_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2c29|Cyp2c38_chr19_39384505_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2a5|Cyp2a22_chr7_26908401_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyp2a5|Cyp2a22_chr7_26908401_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyb5r4|Mrap2_chr9_87102146_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cyb5r4|Mrap2_chr9_87102146_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cwh43|Gm15653_chr5_73462442_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cwh43|Gm15653_chr5_73462442_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ctnna3|Gm22829_chr10_65954135_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ctnna3|Gm22829_chr10_65954135_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ctnna3|Gm22829_chr10_65641163_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ctnna3|Gm22829_chr10_65641163_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Csmd1|Gm25278_chr8_16793530_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Csmd1|Gm25278_chr8_16793530_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Crygf|Gm8809_chr1_66020939_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Crygf|Gm8809_chr1_66020939_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Crispld1|Crisp4_chr1_17960596_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Crispld1|Crisp4_chr1_17960596_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cpa6|Gm22963_chr1_10733171_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cpa6|Gm22963_chr1_10733171_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cops7a|Pianp_chr6_124977845_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cops7a|Pianp_chr6_124977845_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cobl|Gm22156_chr11_12565706_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cobl|Gm22156_chr11_12565706_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cobl|Gm22156_chr11_12510609_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cobl|Gm22156_chr11_12510609_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntnap5a|Gm19965_chr1_116651598_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntnap5a|Gm19965_chr1_116651598_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntnap4|Gm25766_chr8_113284192_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntnap4|Gm25766_chr8_113284192_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm25365_chr9_12770465_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm25365_chr9_12770465_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm25365_chr9_11794908_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm25365_chr9_11794908_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm24496_chr9_10196681_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn5|Gm24496_chr9_10196681_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn3|mmu-mir-6373_chr6_102576285_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cntn3|mmu-mir-6373_chr6_102576285_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cnih3|Ccdc121_chr1_181496163_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cnih3|Ccdc121_chr1_181496163_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Clnk|Gm25505_chr5_39228142_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Clnk|Gm25505_chr5_39228142_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Clec2i|AC159305.1_chr6_128907886_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Clec2i|AC159305.1_chr6_128907886_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cldn18|Gm16004_chr9_99739577_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cldn18|Gm16004_chr9_99739577_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cldn11|Slc7a14_chr3_31185502_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cldn11|Slc7a14_chr3_31185502_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cetn3|Gm24295_chr13_81894723_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cetn3|Gm24295_chr13_81894723_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cers4|Zfp958_chr8_4574563_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cers4|Zfp958_chr8_4574563_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ceacam14|Gm5155_chr7_17860012_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ceacam14|Gm5155_chr7_17860012_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh9|Gm22032_chr15_17578175_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh9|Gm22032_chr15_17578175_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh9|Gm22032_chr15_17160191_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh9|Gm22032_chr15_17160191_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh7|Cdh19_chr1_110330937_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh7|Cdh19_chr1_110330937_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh19|Dsel_chr1_111707137_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh19|Dsel_chr1_111707137_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh19|Dsel_chr1_111256950_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh19|Dsel_chr1_111256950_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh13|Hsbp1_chr8_119334315_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh13|Hsbp1_chr8_119334315_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh12|AC125320.1_chr15_21921033_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdh12|AC125320.1_chr15_21921033_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdc42bpb|A230065H16Rik_chr12_111390059_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cdc42bpb|A230065H16Rik_chr12_111390059_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cd209a|Gm24934_chr8_3758269_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cd209a|Gm24934_chr8_3758269_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ccdc132|Calcr_chr6_3653682_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ccdc132|Calcr_chr6_3653682_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ccbl1|1700084E18Rik/Lrrc8a_chr2_30222272_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ccbl1|1700084E18Rik/Lrrc8a_chr2_30222272_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Calcr|Tfpi2_chr6_3791398_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Calcr|Tfpi2_chr6_3791398_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cadm2|Gm24681_chr16_67633666_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cadm2|Gm24681_chr16_67633666_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cacna1e|Gm9530_chr1_154902275_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Cacna1e|Gm9530_chr1_154902275_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_C6|Mroh2b_chr15_4855407_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_C6|Mroh2b_chr15_4855407_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_C130026I21Rik|Rpl19-ps1/AC167036.1_chr1_84999198_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_C130026I21Rik|Rpl19-ps1/AC167036.1_chr1_84999198_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Btbd11|Pwp1_chr10_85718466_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Btbd11|Pwp1_chr10_85718466_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Brinp1|Gm24697_chr4_68964115_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Brinp1|Gm24697_chr4_68964115_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bhlhe41|Sspn_chr6_145899158_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bhlhe41|Sspn_chr6_145899158_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bcl2a1a|Gm24463_chr9_89071651_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bcl2a1a|Gm24463_chr9_89071651_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bcl11b|Setd3_chr12_108082619_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bcl11b|Setd3_chr12_108082619_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bche|Gm6098_chr3_73735097_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bche|Gm6098_chr3_73735097_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bahcc1|Actg1_chr11_120324940_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Bahcc1|Actg1_chr11_120324940_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC049702|Gm14531_chrX_19665473_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC049702|Gm14531_chrX_19665473_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC040587|Gm26381_chr16_41198457_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC040587|Gm26381_chr16_41198457_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC030500|Gm24847_chr8_59135110_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_BC030500|Gm24847_chr8_59135110_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B630005N14Rik|Gpr85_chr6_13770156_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B630005N14Rik|Gpr85_chr6_13770156_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B4galt5|Slc9a8_chr2_167410007_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B4galt5|Slc9a8_chr2_167410007_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B3galnt1|Gm25621_chr3_69641276_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B3galnt1|Gm25621_chr3_69641276_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B230110C06Rik|Oxsm_chr14_15821276_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B230110C06Rik|Oxsm_chr14_15821276_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B130011K05Rik|Gm12287_chr11_63471510_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_B130011K05Rik|Gm12287_chr11_63471510_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Avpr1a|mmu-mir-6412_chr10_122509538_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Avpr1a|mmu-mir-6412_chr10_122509538_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Atxn1l|Ap1g1_chr8_109742839_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Atxn1l|Ap1g1_chr8_109742839_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Atoh7|Mypn_chr10_63107756_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Atoh7|Mypn_chr10_63107756_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Arhgap31|B4galt4_chr16_38717671_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Arhgap31|B4galt4_chr16_38717671_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Appl2|1500009L16Rik_chr10_83674239_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Appl2|1500009L16Rik_chr10_83674239_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ap3b1|Tbca_chr13_94739317_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ap3b1|Tbca_chr13_94739317_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Amn1|2810474O19Rik_chr6_149271218_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Amn1|2810474O19Rik_chr6_149271218_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Amer2|Spata13_chr14_60566066_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Amer2|Spata13_chr14_60566066_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Alpk2|Gm22567_chr18_65403441_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Alpk2|Gm22567_chr18_65403441_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Aldh1a2|Polr2m/Gcom1_chr9_71428184_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Aldh1a2|Polr2m/Gcom1_chr9_71428184_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akr1c12|Akr1c6_chr13_4342231_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akr1c12|Akr1c6_chr13_4342231_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akp3|Ecel1_chr1_87136964_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akp3|Ecel1_chr1_87136964_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akirin1|Rhbdl2_chr4_123774081_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Akirin1|Rhbdl2_chr4_123774081_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ahctf1/Gm10518|Cdc42bpa_chr1_179897769_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ahctf1/Gm10518|Cdc42bpa_chr1_179897769_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Agl|Frrs1_chr3_116819551_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Agl|Frrs1_chr3_116819551_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Agbl1|Gm23239_chr7_77215982_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Agbl1|Gm23239_chr7_77215982_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Aff3|Lonrf2_chr1_38706730_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Aff3|Lonrf2_chr1_38706730_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adra2a|Gpam_chr19_54998710_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adra2a|Gpam_chr19_54998710_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ada|Wisp2_chr2_163792343_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Ada|Wisp2_chr2_163792343_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adamts5|Gm25715_chr16_86078303_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adamts5|Gm25715_chr16_86078303_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adamts17|1700112J16Rik_chr7_67158729_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adamts17|1700112J16Rik_chr7_67158729_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adam28|Stc1_chr14_68679265_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Adam28|Stc1_chr14_68679265_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Acn9|RP24-378F2.2_chr6_7103405_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Acn9|RP24-378F2.2_chr6_7103405_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abcf3|Vwa5b2_chr16_20576183_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abcf3|Vwa5b2_chr16_20576183_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abcb9|Gm16001_chr5_124107806_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abcb9|Gm16001_chr5_124107806_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abca8b|Abca8a_chr11_110021054_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abca8b|Abca8a_chr11_110021054_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abca13|Eif3s6-ps1_chr11_9711302_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_Abca13|Eif3s6-ps1_chr11_9711302_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AW209491|Gm6556_chr13_15435342_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AW209491|Gm6556_chr13_15435342_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC161214.1|Gm11033_chr8_74352971_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC161214.1|Gm11033_chr8_74352971_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC153847.1|Hace1_chr10_45558222_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC153847.1|Hace1_chr10_45558222_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC147224.1|Cdh12_chr15_20976171_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC147224.1|Cdh12_chr15_20976171_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC140331.1|Dsp/Gm10129_chr13_38111630_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC140331.1|Dsp/Gm10129_chr13_38111630_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC131701.1|Gm17065_chr16_60929060_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC131701.1|Gm17065_chr16_60929060_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC112986.1|Tsn_chr1_117705255_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_AC112986.1|Tsn_chr1_117705255_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A830092H15Rik|Gm25773_chr3_26575124_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A830092H15Rik|Gm25773_chr3_26575124_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A830092H15Rik|Gm25773_chr3_26350715_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A830092H15Rik|Gm25773_chr3_26350715_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A730085K08Rik|9530059O14Rik_chr9_122404983_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A730085K08Rik|9530059O14Rik_chr9_122404983_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A530021J07Rik|Gm10610_chr7_83269366_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A530021J07Rik|Gm10610_chr7_83269366_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A330050F15Rik|Gm22967_chr17_69540374_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_A330050F15Rik|Gm22967_chr17_69540374_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9430038I01Rik|Glrx3_chr7_137416915_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9430038I01Rik|Glrx3_chr7_137416915_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9430020K01Rik|Gm10556_chr18_4698528_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9430020K01Rik|Gm10556_chr18_4698528_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9330185C12Rik|Cntnap5a_chr1_114187154_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_9330185C12Rik|Cntnap5a_chr1_114187154_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5830454E08Rik|Gm23624_chr9_120637309_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5830454E08Rik|Gm23624_chr9_120637309_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5330438D12Rik|Gm26579_chr10_116609579_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5330438D12Rik|Gm26579_chr10_116609579_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5033403F01Rik|Gm23972_chr13_39510183_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5033403F01Rik|Gm23972_chr13_39510183_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5031434O11Rik|Mgst2_chr3_51620151_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_5031434O11Rik|Mgst2_chr3_51620151_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4933402N22Rik|Sema3d_chr5_12167606_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4933402N22Rik|Sema3d_chr5_12167606_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4932415M13Rik|Sult1c2_chr17_53818979_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4932415M13Rik|Sult1c2_chr17_53818979_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930596D02Rik|Gm7853_chr14_35895652_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930596D02Rik|Gm7853_chr14_35895652_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930595M18Rik|Gm8822_chrX_81763808_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930595M18Rik|Gm8822_chrX_81763808_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930595M18Rik|Gm8822_chrX_81648639_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930595M18Rik|Gm8822_chrX_81648639_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930584F24Rik|Dpp6_chr5_26502256_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930584F24Rik|Dpp6_chr5_26502256_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930583K01Rik|Gm23229_chr7_118271654_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930583K01Rik|Gm23229_chr7_118271654_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930577H14Rik|Izumo3_chr4_91976199_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930577H14Rik|Izumo3_chr4_91976199_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930564K09Rik|Fgg_chr3_82976349_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930564K09Rik|Fgg_chr3_82976349_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930558G05Rik|Gm26029_chrX_129148817_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930558G05Rik|Gm26029_chrX_129148817_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930555M17Rik|Pex2_chr3_5521583_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930555M17Rik|Pex2_chr3_5521583_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930527B05Rik|1700071K01Rik_chr11_81549324_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930527B05Rik|1700071K01Rik_chr11_81549324_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930517O19Rik|Gm26367_chr14_100252380_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930517O19Rik|Gm26367_chr14_100252380_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930503H13Rik|Gm7312_chrX_156583623_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930503H13Rik|Gm7312_chrX_156583623_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930442J19Rik|Gm23261_chr2_151337862_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930442J19Rik|Gm23261_chr2_151337862_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930441J16Rik|Lnp_chr2_74441507_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930441J16Rik|Lnp_chr2_74441507_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930441J16Rik|Lnp_chr2_74367782_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930441J16Rik|Lnp_chr2_74367782_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405P13Rik|Scpep1_chr11_88914277_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405P13Rik|Scpep1_chr11_88914277_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Kif2b_chr11_90963493_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Kif2b_chr11_90963493_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Kif2b_chr11_90905474_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Kif2b_chr11_90905474_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Gm11516_chr11_90832941_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930405D11Rik|Gm11516_chr11_90832941_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930401O12Rik|Gm11376_chr13_31236668_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4930401O12Rik|Gm11376_chr13_31236668_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4922501C03Rik|Tbx18_chr9_87590956_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4922501C03Rik|Tbx18_chr9_87590956_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4922501C03Rik|Tbx18_chr9_87495362_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_4922501C03Rik|Tbx18_chr9_87495362_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3110083C13Rik|Fgf9_chr14_58056326_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3110083C13Rik|Fgf9_chr14_58056326_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3100003L05Rik|Gm21957_chr7_124898424_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3100003L05Rik|Gm21957_chr7_124898424_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3100003L05Rik|Gm21957_chr7_124810010_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_3100003L05Rik|Gm21957_chr7_124810010_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2410076I21Rik|Hcn4_chr9_58782312_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2410076I21Rik|Hcn4_chr9_58782312_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2410004P03Rik|Kcnf1_chr12_17125999_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2410004P03Rik|Kcnf1_chr12_17125999_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2310005A03Rik|Itch_chr2_155124405_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_2310005A03Rik|Itch_chr2_155124405_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700116B05Rik|Gm24925_chr16_50911696_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700116B05Rik|Gm24925_chr16_50911696_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700092E19Rik|Gm11353_chr13_26370933_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700092E19Rik|Gm11353_chr13_26370933_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700028E10Rik|Vmn2r18_chr5_151527974_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700028E10Rik|Vmn2r18_chr5_151527974_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700028E10Rik|Vmn2r18_chr5_151454170_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700028E10Rik|Vmn2r18_chr5_151454170_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700024G13Rik|Chat_chr14_32396590_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700024G13Rik|Chat_chr14_32396590_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700020N01Rik|Gm5420_chr10_21645637_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700020N01Rik|Gm5420_chr10_21645637_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700001G01Rik|Gm26235_chr18_17942203_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1700001G01Rik|Gm26235_chr18_17942203_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1500009L16Rik|Nuak1_chr10_83789259_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1500009L16Rik|Nuak1_chr10_83789259_R Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1110019D14Rik|Gm23760_chr6_14088364_F Primer3: not found at this Tm N.d. 0.01
mm2_intergenic_1110019D14Rik|Gm23760_chr6_14088364_R Primer3: not found at this Tm N.d. 0.01
mm2_exon_Ccrn4l_chr3_51241895_F Primer3: not found at this Tm N.d. 0.01
mm2_exon_Ccrn4l_chr3_51241895_R Primer3: not found at this Tm N.d. 0.01
mm4_exon_Olfr323_chr11_58626033_F Primer3: not found at this Tm N.d. 0.01
mm4_exon_Olfr323_chr11_58626033_R Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Gm13855|Gm14546_chr6_34265073_F TCGTCGGCAGCGTCTCCAAACTGCAGCATGGGAA 60.1 0.01
mm4_intergenic_Gm13855|Gm14546_chr6_34265073_R GTCTCGTGGGCTCGGTGGGACATATCAGGCTTGCC 59.8 0.01
mm4_intergenic_5033403F01Rik|Gm23972_chr13_39277256_F TCGTCGGCAGCGTCTCAGGTTCCTTATAGCTGCTGT 58.8 0.01
mm4_intergenic_5033403F01Rik|Gm23972_chr13_39277256_R GTCTCGTGGGCTCGGGTGACATTGTAAGTCTCTTGCCA 58.9 0.01
mm4_intron_Magi2_chr5_19880536_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Magi2_chr5_19880536_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ncor2_chr5_125039953_F TCGTCGGCAGCGTCGCCCTGACCTTGGAACAGAA 59.8 0.00
mm4_intron_Ncor2_chr5_125039953_R GTCTCGTGGGCTCGGGAGTGTACCACTTGGGCCTC 60.0 0.00
mm3_intergenic_Gm26113|Sdk1_chr5_141231364_F Primer3: not found at this Tm N.d. 0.00
mm3_intergenic_Gm26113|Sdk1_chr5_141231364_R Primer3: not found at this Tm N.d. 0.00
mm3_intergenic_Zfp703|Erlin2_chr8_27020452_F Primer3: not found at this Tm N.d. 0.00
mm3_intergenic_Zfp703|Erlin2_chr8_27020452_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Nolc1|Elovl3_chr19_46115709_F TCGTCGGCAGCGTCTCCCTAAGGTCCTCTGCATGA 59.9 0.00
mm4_intergenic_Nolc1|Elovl3_chr19_46115709_R GTCTCGTGGGCTCGGTGGAACCTTGCAGCACTGAA 60.1 0.00
mm4_intergenic_Flrt1|Macrod1_chr19_7151007_F TCGTCGGCAGCGTCGGGAGTCCCACAGGGCAC 62.0 0.00
mm4_intergenic_Flrt1|Macrod1_chr19_7151007_R GTCTCGTGGGCTCGGTCTGTGCCAGATGCTCTGTG 60.0 0.00
mm4_intergenic_Rxra|2810430I11Rik_chr2_27852771_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rxra|2810430I11Rik_chr2_27852771_R Primer3: not found at this Tm N.d. 0.00
mm3_intron_Pikfyve_chr1_65211930_F Primer3: not found at this Tm N.d. 0.00
mm3_intron_Pikfyve_chr1_65211930_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Srgap3_chr6_112879172_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Srgap3_chr6_112879172_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc16a5_chr11_115467245_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Slc16a5_chr11_115467245_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Sez6_chr11_77950851_F TCGTCGGCAGCGTCTGAGCGCCAAGTCACTGATT 59.9 0.00
mm4_intron_Sez6_chr11_77950851_R GTCTCGTGGGCTCGGACTAGATACCCAGCCAGGCT 59.7 0.00
mm4_intron_Plxna4_chr6_32520209_F TCGTCGGCAGCGTCTCCAACATCTGTTCCCCAGC 59.9 0.00
mm4_intron_Plxna4_chr6_32520209_R GTCTCGTGGGCTCGGTAGTGAGCATACCAGCCCCT 60.0 0.00
mm4_intron_Gm12436_chr4_48910018_F TCGTCGGCAGCGTCGCCTTTCAGAAACAACTCTCAGAC 60.0 0.00
mm4_intron_Gm12436_chr4_48910018_R GTCTCGTGGGCTCGGACACATCTTCAGAAGTGGCCT 59.2 0.00
mm4_intron_Cdh2_chr18_16788787_F TCGTCGGCAGCGTCCCTGAAGGCTGCACATGTAAG 59.2 0.00
mm4_intron_Cdh2_chr18_16788787_R GTCTCGTGGGCTCGGGGGCATCTGTGATCTCCCAG 59.8 0.00
mm4_intron_1600020E01Rik_chr6_86560755_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_1600020E01Rik_chr6_86560755_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpia|Eif2ak3_chr6_70793748_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Rpia|Eif2ak3_chr6_70793748_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Krtap10-10|Gm10318_chr10_77847144_F TCGTCGGCAGCGTCCTGTGTACCTGTCTGCTGCA 59.9 0.00
mm4_intergenic_Krtap10-10|Gm10318_chr10_77847144_R GTCTCGTGGGCTCGGAGGCTTACAACAGACAGGCA 59.2 0.00
mm4_intergenic_Gm3272|Mmp2_chr8_92768201_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm3272|Mmp2_chr8_92768201_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11461|Gm11462_chr2_165927917_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm11461|Gm11462_chr2_165927917_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Aggf1|Crhbp_chr13_95426696_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Aggf1|Crhbp_chr13_95426696_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Nell1_chr7_50098302_F TCGTCGGCAGCGTCTTGTCGATTTGCTCCCAGCT 59.9 0.00
mm4_exon_Nell1_chr7_50098302_R GTCTCGTGGGCTCGGCAGCCACCCAAGAGACTCAG 60.0 0.00

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

mm3_intergenic_Gm6189|Dock10_chr1_80385195 TTGTAGTGCAGACGGCCTTTGCTGGAGTTGCGGAGCGCCTTCAGGGTTTCCCAGCTGTGACCATCGGACGGCCTTGACCT
GGGGAGCACCATCTTCTCTGAAGGAGGACTAAGACACGAGAGAAAGAGG
mm4_intron_Mpped1_chr15_83851103 CCATTCTGTGGCTGGGTCTTGATCCCTGGTTCTCCCTTTATGCACCTGGAGTGAGAATCATGACCCCCTCTGGCCCAGGG
ACAGGGCCACCTTCTTCACTGGCGGCTCTTGAGGCTGCTCCAGTGGGCAGAGGAAGCAG
mm4_intergenic_Gm11260|Gm11261_chr4_78381439 GGTACTCTAACCCTGAGAGTGGTTCTCCTACAGGGAAGATGGTTCTCCAAGAATGAGAGTGAACTTGCCACAATGAAGGT
AGTCCTCCTCTAGGAGTGAGAGTGATCCTCCCACAGTGAGGGTGGCACTCACTGAGTA
mm4_intergenic_Satb2|Gm23943_chr1_56997480 GCATGGGATGGGTGCTAGAGAAGGAGAATCAGGTAGAAGGCTCCTCTACAATCCCCACCAGAGAAGGTGGTGGCCTGGTG
ACACTCAAGAGTATTGACAAATGTGAGCTATTTATTTAGCGTGGTATATTGTCCAGCT
mm4_intergenic_Gm15443|Gm23535_chr1_149344327 ACTCAATGGAATCTCTAGGACAGTTTTGTTAATACTTAAAAGAAAACCCACAGGGAAGATAGTTCCCCAGAGGAAGGAGA
TAAAGAAGAAGAAAAGGCTATGCCAGTTGAGTTATCATATATGAGATCAGCCCCATGCC
mm4_intergenic_Gm5039|Gm10264_chr12_88327435 TCGTCTTTCTTACTTGTGTCTTAGTCCTCCTTCAGAGAAGATGGAGCTCCCCAAGTAGGTTGTTGGTTCCAGTCCTG
mm4_intron_Pde8b_chr13_95159698 AAAATGGCCCACACCAGGAATACCATGGATACTAGGACCCTCCAGAGAAAATGCTGTCCCCCAGCAGGACATCCATGGAA
ACTAGGACCCCACCCCAAGAGATGATG
mm4_exon_Srpk1_chr17_28603497 CGGAAGCCCCTGATAGTTGGACTTGATGATCCACTTGAGTAGATGATGCCCCAAAACCTCAAACACCATGCAGATATCTA
GGAGTTCATTAAGGNNNNNNNNNNNNNNNNNNNNNNNNGAGGCCCAAGGAAGCAGGTAG
mm3_intergenic_Tmem45b|Barx2_chr9_31730676 GACACAGCTGTTTCCCAGGAACTCATCATCAACTTACTCTCTAAACAAGTATCTACTGTATGTGGAGCACCAGATTCTCT
GGAGG
CAATGCCTAAGAAGTGGGAGAGCC
mm4_intergenic_D030018L15Rik|2610037D02Rik_chr15_96090558 TCAGGAGCTGAAGGAGAGAGATGAATACTGACTTTTAAACATATAACATTGGGAAAGCAGGTTTGGGAGACAATCTTCCC
TGGAGG
CAACCTTGATTTAAGCCTCGTGGAGGACACTGTACACTCAGC
mm4_intergenic_Gm23117|Gm5083_chr13_44077572 GACTCAGGCAAGTGGAGGTGGAGAGTTCAAATTACAGGGAAGAAATAGAACAGTCGATGGAGACCCCTCTGAGAAGATGG
AGCCCTA
GGCTAAAAAGATGAAAGAGACTATATCCCAGCAGTTAAAATGAAGAGGA
mm4_intergenic_Mettl18|Sele_chr1_164023491 TGCAATTTATTGTTCCCTTTCTTGTATCTTTTTTGTATCCAGTGTATTTCTACTTGACTTTAAGTCATGGCTTAGACACC
ATTTTCTCTGGTGG
TTGGTCTGTTTCCCCTTCATGCCA
mm4_intergenic_Gm13857|Bpgm_chr6_34448721 TGCAATTTCTTGTTTTCTTCCTTGTATCTTTATCCAGTGAATTTCTACTTAACTTTAAGCCATAGCTTAGACACCATTTT
CTCTGGTGG
TTGGTCATTTTACCCATCTGTTTCTTCTTCATGCC
mm4_intron_Gm6086_chr1_94004964 TGTTCTTATGTCACCTGGTGCATGGGGCACAGTCATCTCAGGAGGAGTTCCCACCCTTCCCAGTA
mm4_intergenic_Gm11546|AA623943_chr11_94804402 TGAGGTGTGTGTTCCAACCCCAAGGTGGTGGGGGACCATCATCTCAGAGGGTGAAGTCTTCCCTCTTCCATTCTTCTCTG
GTGTGAGCAGAAGACACATGCCCAGCTC
mm4_intergenic_AA623943|Gm11543_chr11_94819994 TGAGGTGTGTGTTCCAACCCCAAGGTGGTGGGGGACCATCATCTCAGAGGGTGAAGTCTTCCCTCTTCCATTCTTCTCTG
GTGTGAGCAGAAGACACATGCCCAGCTC
mm4_intron_Lyn_chr4_3779601 CACACTTCCTGCCAGCACTAAGTGGCACCTTCTTCTCTCGAGGTCATTGTCTATTGGAATCCTTCATTCTGCCTCATGCC
CTTGCTTTGTTGTCAG
mm4_intergenic_Trim29|Pvrl1_chr9_43667943 AATGGCAAGTGGAAGGCGTATGAACCTTCTGTGGAGCATCCCCACTGCAGCCTGATGATCCCAGAGAGAAGAAGCTGCCC
CA
CATGGAAGCTTATCTAGGGTCAATGAGACTGCCTGA
mm4_exon_Ctdsp1_chr1_74396068 GCTGACCTGAGAGGAACCAATTTCTCCCCTTTCCCTCCTCCCTCCTGGGATGACGGTGCCCCACCAGTTTGTACGTGGGC
AGGAGA
mm4_intron_Casz1_chr4_148932197 GGAGGTTGGCAAGAGGTGAGATCCTGGGGCTTCATCTTCCCAGGGGGTCCGTGTGACATTAGGGTCCATGTGACATTAGG
CGTGATCCTCCAGCCAGGCCGACCCCGGACTCACAGTGGCTTCCTC
mm4_intergenic_Gm22207|Gm5607_chr8_12385355 CAAGAGGTAGGGAAAGCCGGAAAGCCGCTCCAGGTGACAGTCGCCGCCCGTGGGATGCCACAAGTGACTGCTGACAGGGA
TAGGGGGTGCCATCGTCTCTGGAGGAGGGGGAGGAATCCCTATGGTCCAAGGGTCCCGAA
mm4_intergenic_9230104M06Rik/Brf1|Pacs2_chr12_113002304 CAGCAAGTTCTTCAGCCCCTACAGAGGAACCAGGTGGAGCCCTATCTTCTTTGGAGGGCCTGGGGATGCTTCCCTGCCAT
TCT
mm4_intron_Zfp618_chr4_63093902 GAGCACTTGGGCAGATCACTTCTCTTTAGTTTGCTCATACGTTCATAGGAGTCTCCCTCCGTGGTTGAGAGAACCCCAAG
AGAAGAGTGTGGCCCA
GCTACCTTGCTCACAGTTACATCTGGCCTTCACCATGG
mm4_intron_Scamp5_chr9_57464406 TCAAGGCCTCCAGCAAAACAAGGTAGACAAGTAGGGAAGTGGAGGTAAAAACTAAGTCATAGGAGCCTCAAGGGAAGATG
CTCCCCCA
GCTCTCACTGCAGCCTGACCCCGATCACAGGCCCCAAGTCATTTCTCCA
mm4_intron_Slc8a1_chr17_81560217 GCTGGCTTCTTCAAGTTGGCTTAGGTATATGAGCTGCAGAACCATCTTCTCTGCAGGAGTCTTTGCAATGCAGCTAGGGC
CAACTGGAAA
mm3_exon_Igfn1_chr1_135968829 GCATTGCCAGACACTTGAGCCCAGTGGCCCTCTGAACCGGCCTCATGAGGAGATGGTGCCCCAGGGTGCCTGGCTTTGTC
CCAATTCCCAGTTCCAACTGTAGAGGTCCTGGCACCAAGAAA
mm4_intron_Arhgdib_chr6_136935663 TGATGCAGCTGGTGGATGTTGCAGTTTGAGGACAACCTTTAAGGGGCTGATGCAGAACAAGTTAGAAAAGACGAATCAGA
TGAGGCACATTCTTATCTGGTGGTCATGACAGCCTAACGGATAGCCAGAGTGGAGA
mm4_intergenic_Purb/Gm22123/Gm11973|Gm11973_chr11_6481718 AAGAGACAGGTGTGGGAGGTGAGGGGAAGGGTGCACACACAGCCCTGATGGGACACCCTCTTCTCTCATGGGCTTCTGCC
AACAGCTGACTCTACAGAGCCTCCACGT
mm4_intron_Dennd1a_chr2_38030070 AAGGAGCTGGTGTGGTGATGCAGATTGTGTAGCACCAGCTTCTCAGGAGGGTGAGCTGGGAGAGTTGTGAGCAGG
mm4_exon_Zcchc5_chrX_106839316 CCCCTGAACTCTGTGATGGCTGAGGATTCTCCAGACTCATTGGTCTCTGGGGGCTCCTGGGGCTCCTTGATCTCTGGGGG
TTCCCTGAGCTCACTGATGGCTGAGG
mm4_intergenic_Slco5a1|Gm5250_chr1_12994738 ACTTCTGATCTCGGCTCCCTGGTCACAGCAGAAGGTTCCCTGCCCTGCAGGCTGTAGCAGGGGCACCAGCTTCCCTGCAG
G
CAGGGTGTATCCATATATCCCTTCCTAGATGCTGTTTGTTAGACCCTTCTGG
mm4_exon_Wbp1_chr6_83120848 GGTTCCAGCTCGTCTCCAAATTGCTCCCTCAAGAGAAGATGCTGCCGGACTCTGCTGTGACAATAGGCACAGAGAAAAAC
ATCACAAATAACTGCTGCAAGACAGAGGGAA
mm4_intron_Camta1_chr4_151740015 CCCCAAGCTTCCAGTACCTGCACTCCAGTGAACTTCCTTAAACAGCCCACCCACCCAGCAGCCTGTCCTCCAGAGGAGAT
GGGGTCCCT
CCTCCCACAAACTACACACGGG
mm4_intron_Glis1_chr4_107633146 GGAGGCCACCAGTAAACACAGACCTGTGGCTCCATCATCCCTGGGGGCTTTGCTGTGTGTGCATACACACGTCCTCTGTG
TCTGTGTTCTCCCTTGCC
mm4_intergenic_Gm26565/Celf2|Celf2_chr2_7082538 TTCTTGAGCACAGCCTCCTGGGCTTGGGCTCGGTCTTCTCTGGGGGATTTTCACTCTTACTAATGCTTCTCAGCAGCTAT
GGCAGGAACGCTTGCCCCTGTCACCTGTCCTCACAGGATCCTGAGGCAGA
mm4_intron_Kdm4b_chr17_56384532 TTGCACTGATGGGTGAGTCCTCAAGAAGCTCTGTCCTCAAGAAGTAATGAAGTCTGAGGCAGCACCTCCTCTGGAGGGGC
TTGGCCTTAGTGGCCCGACTGCTTTCCTTCTTTGTGGCTTAGGGTGTGACTTCG
mm4_intergenic_Pfkl|Aire_chr10_78010762 GATCTGGGCTGCCATGGTAGGGCTGTCCTGCAGAGATGAGGGTACCCCATCTGACCCTGACAGTTTGTTGA
mm4_exon_Fam171b_chr2_83812948 CTCCGACCTCAGCCTCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGGAGGCAGAGGAGGGGA
GGCCGGAGGTGCCTGGGGCATCCTCTACTTTGGTGGCTCCAGGTACGTCTCGGTAGC
mm4_exon_Ptprd_chr4_76091455 GTGGTGGACACTAGCTTGGGCTTGCTTCGAGCACCATCTCCTTTGGTGGTGTAAGCTGTGACAGTAAGGGAGTATGAAGT
TTCAGGCTGTAGCCCAGAGATGATCATGTCC
mm4_intron_Ttll11_chr2_35954625 CCCTGGCCTTCCTTTCCTTTCCAATAATGGAGGATGTTTTGGCTTCATTCTGAAGCACACAGTACAGTCAAAATAATGTC
CCCAAGAGAAGAGGTTCCCCCA
GAGGACTCATTTGGCTAAGGTAGATGTGCTCAGGGC
mm3_intron_Sntb1_chr15_55726654 GAGTGCACAAACGCAACTGTGCAGAATTGCTCTTTATTCCTGGGTCCCCATTTTCTCTGGAGGTAGTTGAAACAAATTTT
TGAACGTCAAAACAGCCTTCTTAATAGCATGACTGAGTTTACAGTCCACCTTGCTTTGC
mm4_intergenic_Tcerg1l|Mapk1ip1_chr7_138647697 CCTCCAGGTTAGGGACACAAGAAGGAAGAGCTAAGGCTCTGTCCATGGTGACCCATCTTCTATGGTGGACAGTTAGCATG
GGTATGGACAAGCAGGCAGGACATCT
mm4_intergenic_Gm23355|Gm21833_chr16_82772668 TTTCTGGCAGCAACCCTGAGGCAACCTCCAAAGAAGATGGGACACCAACATGTTCTACCTGGGACCTGTTCCAAGTATGA
CAACAGTAGACACTCAGGCAAAAAACAGCCCTGCACCTAACCTGCCTCCAGAG
mm4_intron_Cers6_chr2_69098837 GGCCTGTCTCTCTGGAAACCAGAGCAAGCAGTAACAGGCAGAGGAGATGTTCTGCCCATGTGCCAAGCAACAGACCCATG
GGGCACCACCTCCGCTGTGGG
ATGGCAATGGCTTGGCTCTGAGCAT
mm4_intergenic_Gm10845|Gm6999_chr14_79872545 GCCTCACCACACCTACTCACTCCCAGGGGAGATGAACCCAGAGAGAAGAGGGAGCCCCAGGCAACTGCAGTCTGCCCTCC
ATGGCAGATGGCAGAGAGAGACCCTCAGA
mm4_intron_Nelfa_chr5_33900140 ACCCAAGCTTATGTCTGCCCCTGAAAGAATCATTCCTCTACAGAATGCCTCATCTGGGAAGAGAAAATCCTTGGCTTCCC
CTCCTAGCACCCCCACCCCCAAAGAACAGGGTGCCCAAAGTGGCAATCTTGGCAGCTA
mm3_intergenic_Cd47|Gm8824_chr16_50080516 GCCCATGCCAATATGCACAGGAGTCCCCAGAGATGATGATGCCCTACACCTCCTCTGCTGGTGTATGCGGAGAA
mm4_intergenic_Gm23829|Gm5974_chr1_48125463 TGTCTTCCACACACACACACAAAAAGAATGTTTATAATGGAGGAATCAAGAAATTGGGATATTTTCGTATTTCAATATAT
TTCAAGAAAATTGGTCACCCTTTTCTCTGGAGGAACCTTGAGAGCTCAGCAAA
mm3_intergenic_Gm25460|Gm5263_chr1_146079367 AGGTTTGTGGTGGTCCAATGTGATGTTTCAGGAACCATCTTCTCTGGAGAAATCTTTCCTTGTATACTTTCAGTAGTGCC
ATATGATTGAAAGTCATTTAAAAAGCAATAGATTGAGCGTGATATGGTGGCAGA
mm4_intergenic_Depdc5|Ywhah_chr5_33001084 AAACCAAGGGTCCCAAGTGGAGTGGGGAACCAACTTGTCTGAGGGTGGGGTCGGTTGGTGGAGCTGGCCCAGGCTGGGTC
TCTGTGCTCGTCTTCCTGATTCTTTCTCATGCTCTGACTCTGCTCTGCATCTGC
mm3_intergenic_Wisp3|Fyn_chr10_39210407 CACCCTCATGCTACAGAGTCAAACCCATTATACTGTGTGAGACACCATCATCTCTGGAGATGGGGGTAGCTTTGGCACAT
GA
mm4_exon_Abcb8_chr5_24408572 CCCCTGTCCTGTCCTCTCTTTCCCTAGGTGAGCGGGGCACAACCTTGTCTGGTGGCCAGAAGCAGCGCCTAGCCATCGCA
CGTGCCCTCATCAAGCAGCCCACAGTGCTGATCCTGGACGAG
mm4_intron_Map1b_chr13_99466263 CACACTGCCTCAGTCCAGAGGCTCTCTGCATGGGAGCACCAGCTTGTCTGGAGGATCTGAGCTCCATCTCAGTTCTGACA
ACACCCCTCCC
mm4_intron_Csmd3_chr15_48791689 GCTTGCTAGCCTCTCTCAGGCGACAAGTCAAGCCCATGTCCACCACAGAAGAGGGTACCCCGGAAAACAGACCTACCTTT
TACACAAGACAGCGTCAATAAAAAGACGAGGTTCCAAAACGT
mm4_intergenic_E130006D01Rik|Miat/MIAT_exon5_3/MIAT_exon5_2/Gm26953/MIAT_exon5_1_chr5_111886854 AAGTCCCCACATGTCACACCCTGGATTCCTCTTTGCTTTGTTCAAGGTGGCACCATCTAGTCTGGTGGGGACTAGTCACA
TGTTTCATCCTTGCACAGACTCTATGGGCAC
mm4_intron_Crtac1_chr19_42317038 GTGTCCTCTGGGTATGCCAGCTGCCCCGGCCTCCTCCATCCCTCCACAGAAGCTGCTGCCCCCGCCTTGGGTTGCCCTAT
CCTTCCAGCA
mm4_intergenic_Gm13855|Gm14546_chr6_34265073 TCCAAACTGCAGCATGGGAAACAGCCTGGCTCTCTCTTGGAACAGCCTCTTCTCTGGTGAGCGCGGCAAGCCTGATATGT
CCCA
mm4_intergenic_5033403F01Rik|Gm23972_chr13_39277256 TCAGGTTCCTTATAGCTGCTGTTACTGTTCTCAATCATCATTACTCCTCCAGGAAAGGGGGTGCCCCAAGCAGGTATCTA
CCATGAAGATTTTTATGGCAAGAGACTTACAATGTCAC
mm4_intron_Ncor2_chr5_125039953 GCCCTGACCTTGGAACAGAAACTGACAGCTAAGGGTTTCCCGGATCACCTCCATACAGTCCTAGGCTGTCCTCCAGGAAA
GCTGGAGCCCCA
GCAGAGGCCCAAGTGGTACACTC
mm4_intergenic_Nolc1|Elovl3_chr19_46115709 TCCCTAAGGTCCTCTGCATGACCAGTACTTTGGTGCACACTCTTTTCTGGGGGCACTCATTTGCTTCATCTTAATTTCTT
CAGTGCTGCAAGGTTCCA
mm4_intergenic_Flrt1|Macrod1_chr19_7151007 GGGAGTCCCACAGGGCACGGAGCCCCCACAGAGCAGGGTGCCCCACAGAGCAGGGTGCCCCCACAGGGCAGGGTGCCCCA
CAGGGCAGGGTGCCCCACAGGGCAGGGTGCCCCCACAGAGCATCTGGCACAGA
mm4_intron_Sez6_chr11_77950851 TGAGCGCCAAGTCACTGATTTAGATGAAAGACACCCAGGATTGTCGGACCATCTGCTCTGGGGGATATAAGCCTGGCTGG
GTATCTAGT
mm4_intron_Plxna4_chr6_32520209 TCCAACATCTGTTCCCCAGCCTTTGAAAGTGACAGCTATTCGGGCACCATATGCTCTGCTGGCTAACAGGGCTCTCACTG
CAGCTCTGCCAAGAGCCAAATTCCAGAGGGGCTGGTATGCTCACTA
mm4_intron_Gm12436_chr4_48910018 GCCTTTCAGAAACAACTCTCAGACAAATAGTGCATCAACCCACCAGGACAGATGGTGCCCCTGAGGCCACTTCTGAAGAT
GTGT
mm4_intron_Cdh2_chr18_16788787 CCTGAAGGCTGCACATGTAAGAACCATCAGAGCAGCTGGTGCCCAACCTGTCTCCCACTGCTCCCACTGGGAGTCACTGG
CCCTCAGAAAACAAGAAGGGTGAGCTCATTTTCCATGCTGGGAGATCACAGATGCCC
mm4_intergenic_Krtap10-10|Gm10318_chr10_77847144 CTGTGTACCTGTCTGCTGCACACCTGTGTGCTGCAAGCCAGTGTGCTGTGTCTCCATCTGCTCTGGGGGCCAGCCAGCAT
GCTGCACCTCCTCCCCCTGTCAGCCCTCCTGCTGTGTGCCTGTCTGTTGTAAGCCT
mm4_exon_Nell1_chr7_50098302 TTGTCGATTTGCTCCCAGCTCCCAGCTCCCAGTGGTGTACATTCTGGGGAACCATCTGCCCAGGAGGTCAGCCGTCTTGC
TGAGTCTCTTGGGTGGCTG

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.

After sequencing, run CRISPRessoPooled. The tool will map the reads to the amplicons and analyse the mutations:
CRISPRessoPooled -r1 Reads1.fastq.gz -r2 Reads2.fastq.gz -f crisporAmplicons_mN1FkRligAThyqKv3eg3.txt --name MY_EXPERIMENT

Version 5.01 - Documentation  - Contact us - Downloads/local installation - Citation - License
CRISPR/Cas9 Guide Designer for chordate vertebrate ecdysozoans lophotrochozoans protostomes spongi corals plants butterflies metazoans genomes fruitflies insects nematodes mammals.