← return to the list of all guides
Contents:In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.
In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.
If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.
| Name | Primer Sequence | Tm | CFD Score |
|---|---|---|---|
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313861_F | TCGTCGGCAGCGTCAGGGAGCCTGGGATTAGGAG | 60.1 | 1.00 |
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313861_R | GTCTCGTGGGCTCGGTACCAACCAGAGTGCCAAGC | 60.2 | 1.00 |
| mm3_intergenic_Prrxl1|3425401B19Rik_chr14_32655186_F | Primer3: not found at this Tm | N.d. | 0.74 |
| mm3_intergenic_Prrxl1|3425401B19Rik_chr14_32655186_R | Primer3: not found at this Tm | N.d. | 0.74 |
| mm4_intergenic_3110039M20Rik|Gm9804_chr12_49394182_F | Primer3: not found at this Tm | N.d. | 0.69 |
| mm4_intergenic_3110039M20Rik|Gm9804_chr12_49394182_R | Primer3: not found at this Tm | N.d. | 0.69 |
| mm4_intergenic_Gm24295|Mef2c_chr13_83371258_F | Primer3: not found at this Tm | N.d. | 0.61 |
| mm4_intergenic_Gm24295|Mef2c_chr13_83371258_R | Primer3: not found at this Tm | N.d. | 0.61 |
| mm3_intergenic_Gm21820|AC132591.1_chrY_5249701_F | Primer3: not found at this Tm | N.d. | 0.56 |
| mm3_intergenic_Gm21820|AC132591.1_chrY_5249701_R | Primer3: not found at this Tm | N.d. | 0.56 |
| mm4_intron_Chsy3_chr18_59363487_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Chsy3_chr18_59363487_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Rpl21-ps10|Gm25574_chr3_38264253_F | Primer3: not found at this Tm | N.d. | 0.50 |
| mm4_intergenic_Rpl21-ps10|Gm25574_chr3_38264253_R | Primer3: not found at this Tm | N.d. | 0.50 |
| mm4_intron_Dennd1b_chr1_139113909_F | Primer3: not found at this Tm | N.d. | 0.48 |
| mm4_intron_Dennd1b_chr1_139113909_R | Primer3: not found at this Tm | N.d. | 0.48 |
| mm4_exon_C920009B18Rik_chr10_22308142_F | Primer3: not found at this Tm | N.d. | 0.46 |
| mm4_exon_C920009B18Rik_chr10_22308142_R | Primer3: not found at this Tm | N.d. | 0.46 |
| mm4_intergenic_Gm24870|Srek1_chr13_103651837_F | Primer3: not found at this Tm | N.d. | 0.46 |
| mm4_intergenic_Gm24870|Srek1_chr13_103651837_R | Primer3: not found at this Tm | N.d. | 0.46 |
| mm4_intron_C130026I21Rik_chr1_85244118_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_C130026I21Rik_chr1_85244118_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_AC132444.1_chr1_GL456221_random_20397_F | TCGTCGGCAGCGTCCTTCTGACCTCCAGTGCCAC | 60.3 | 0.45 |
| mm4_intron_AC132444.1_chr1_GL456221_random_20397_R | GTCTCGTGGGCTCGGCCAGTCCAGGGGCAGGAG | 61.4 | 0.45 |
| mm4_intergenic_Gm16026|Gm2619_chr1_85286999_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Gm16026|Gm2619_chr1_85286999_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Gap|AC168977.2_chr1_GL456212_random_4394_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Gap|AC168977.2_chr1_GL456212_random_4394_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Gap|AC133103.4_chr1_GL456211_random_20413_F | TCGTCGGCAGCGTCCTTCTGACCTCCAGTGCCAC | 60.3 | 0.45 |
| mm4_intergenic_Gap|AC133103.4_chr1_GL456211_random_20413_R | GTCTCGTGGGCTCGGCCAGTCCAGGGGCAGGAG | 61.4 | 0.45 |
| mm4_intergenic_Csprs|Gap_chr1_GL456221_random_202615_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Csprs|Gap_chr1_GL456221_random_202615_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_AC133103.1|AC133103.3_chr1_GL456211_random_199084_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_AC133103.1|AC133103.3_chr1_GL456211_random_199084_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Gm20682|3300002A11Rik_chr12_99314415_F | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intergenic_Gm20682|3300002A11Rik_chr12_99314415_R | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intergenic_Olfr683|Olfr684_chr7_105148470_F | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intergenic_Olfr683|Olfr684_chr7_105148470_R | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intergenic_Gm12666|Gm12638_chr4_92366492_F | TCGTCGGCAGCGTCACATGGCAGGAATGACTGATTC | 58.7 | 0.40 |
| mm4_intergenic_Gm12666|Gm12638_chr4_92366492_R | GTCTCGTGGGCTCGGAAAGCCTGTGTTCCTCTGGC | 60.5 | 0.40 |
| mm4_intergenic_Chrne|Gm12315_chr11_70620574_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Chrne|Gm12315_chr11_70620574_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_2010300C02Rik|Tsga10_chr1_37725612_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_2010300C02Rik|Tsga10_chr1_37725612_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Mllt3_chr4_88019620_F | Primer3: not found at this Tm | N.d. | 0.33 |
| mm4_intron_Mllt3_chr4_88019620_R | Primer3: not found at this Tm | N.d. | 0.33 |
| mm4_intergenic_Gm24601|Gm26501_chr6_95071875_F | Primer3: not found at this Tm | N.d. | 0.33 |
| mm4_intergenic_Gm24601|Gm26501_chr6_95071875_R | Primer3: not found at this Tm | N.d. | 0.33 |
| mm4_intergenic_Gm6806|Gm22332_chrX_68545507_F | TCGTCGGCAGCGTCACTTTAATCCCTTCTGAGAGGAGA | 58.4 | 0.32 |
| mm4_intergenic_Gm6806|Gm22332_chrX_68545507_R | GTCTCGTGGGCTCGGACAGGTTGCTTACAAGATTTCATGT | 59.4 | 0.32 |
| mm4_intergenic_Olfr1216|Olfr1217_chr2_89016208_F | Primer3: not found at this Tm | N.d. | 0.32 |
| mm4_intergenic_Olfr1216|Olfr1217_chr2_89016208_R | Primer3: not found at this Tm | N.d. | 0.32 |
| mm3_intergenic_Gm22507|Trhde_chr10_113775253_F | Primer3: not found at this Tm | N.d. | 0.32 |
| mm3_intergenic_Gm22507|Trhde_chr10_113775253_R | Primer3: not found at this Tm | N.d. | 0.32 |
| mm4_intergenic_Gm4487|Gm24073_chr14_114444731_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Gm4487|Gm24073_chr14_114444731_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_D830050J10Rik/Raf1|Gm24008_chr6_115698941_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_D830050J10Rik/Raf1|Gm24008_chr6_115698941_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Gm27039|Adcyap1_chr17_93119687_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Gm27039|Adcyap1_chr17_93119687_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Gm15323|Ankrd55_chr13_112019939_F | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intergenic_Gm15323|Ankrd55_chr13_112019939_R | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intron_Ush2a_chr1_188423843_F | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intron_Ush2a_chr1_188423843_R | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Nr5a2|Gm23763_chr1_136969415_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Nr5a2|Gm23763_chr1_136969415_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intron_Ocln_chr13_100522985_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intron_Ocln_chr13_100522985_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_AC121988.1|Gm25740_chr10_46135492_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_AC121988.1|Gm25740_chr10_46135492_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intron_Serpini1_chr3_75627183_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intron_Serpini1_chr3_75627183_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_Eif3b|Chst12_chr5_140492229_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_Eif3b|Chst12_chr5_140492229_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_Mup-ps19|Mup-ps20_chr4_61986659_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_Mup-ps19|Mup-ps20_chr4_61986659_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_4930470P17Rik|Gm14264_chr2_170643378_F | TCGTCGGCAGCGTCAATGAAGGAGCCAGGATGCC | 60.1 | 0.25 |
| mm4_intergenic_4930470P17Rik|Gm14264_chr2_170643378_R | GTCTCGTGGGCTCGGACTCTGTGGTTCAGCTTGCA | 59.8 | 0.25 |
| mm4_intergenic_Gm22828|Gm23960_chr6_20030556_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Gm22828|Gm23960_chr6_20030556_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Ctbp2|Tex36_chr7_133174133_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Ctbp2|Tex36_chr7_133174133_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_Nek7|Lhx9_chr1_138796466_F | Primer3: not found at this Tm | N.d. | 0.24 |
| mm3_intergenic_Nek7|Lhx9_chr1_138796466_R | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intergenic_Gm15212|Gm15214_chrX_163293656_F | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intergenic_Gm15212|Gm15214_chrX_163293656_R | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intron_Kcnq3_chr15_66139276_F | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intron_Kcnq3_chr15_66139276_R | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intergenic_Gm24683|Gm14904_chrX_116193666_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm24683|Gm14904_chrX_116193666_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm14972|Gm382_chrX_127016526_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm14972|Gm382_chrX_127016526_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm23131|Lphn2_chr3_148602648_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm23131|Lphn2_chr3_148602648_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm13458|Gm13455_chr2_40228717_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm13458|Gm13455_chr2_40228717_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm3_intergenic_Apoo-ps|Zswim6_chr13_107503191_F | Primer3: not found at this Tm | N.d. | 0.22 |
| mm3_intergenic_Apoo-ps|Zswim6_chr13_107503191_R | Primer3: not found at this Tm | N.d. | 0.22 |
| mm3_intron_Tceal3_chrX_136660267_F | Primer3: not found at this Tm | N.d. | 0.22 |
| mm3_intron_Tceal3_chrX_136660267_R | Primer3: not found at this Tm | N.d. | 0.22 |
| mm4_intron_Zswim4_chr8_84228522_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intron_Zswim4_chr8_84228522_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm3_exon_Nudt12_chr17_59002284_F | TCGTCGGCAGCGTCAGAATGCTTGCTGCTTCCCT | 59.9 | 0.21 |
| mm3_exon_Nudt12_chr17_59002284_R | GTCTCGTGGGCTCGGAGCTGGCCCTCTAATGTGTT | 59.0 | 0.21 |
| mm4_intergenic_Gm23752|Gm24815_chr12_7234512_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Gm23752|Gm24815_chr12_7234512_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Rbm27|Pou4f3_chr18_42372214_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Rbm27|Pou4f3_chr18_42372214_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Gm14643|Gm26194_chrX_39928245_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm14643|Gm26194_chrX_39928245_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Dclk3_chr9_111451033_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Dclk3_chr9_111451033_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm14765|Tab3_chrX_85449880_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm14765|Tab3_chrX_85449880_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm3_intergenic_Gm23240|Gm8357_chr1_48540336_F | TCGTCGGCAGCGTCAAATAATATGACTTAAGGCACACGT | 57.1 | 0.20 |
| mm3_intergenic_Gm23240|Gm8357_chr1_48540336_R | GTCTCGTGGGCTCGGCTGCACATCCTATTTAAGTTTCAGA | 57.3 | 0.20 |
| mm4_intron_Pydc4_chr1_173585876_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Pydc4_chr1_173585876_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm12020|Gm12022_chr11_18375933_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm12020|Gm12022_chr11_18375933_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm3_intergenic_Slc1a3|Gm5210_chr15_8741318_F | TCGTCGGCAGCGTCACGATGTGTGTGGAGACATGT | 59.6 | 0.19 |
| mm3_intergenic_Slc1a3|Gm5210_chr15_8741318_R | GTCTCGTGGGCTCGGACAATCCATGACAGCTGCCA | 59.9 | 0.19 |
| mm2_exon_Foxj3_chr4_119627260_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm2_exon_Foxj3_chr4_119627260_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Hbs1l_chr10_21313801_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Hbs1l_chr10_21313801_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm10051|Gm15627_chr5_133683820_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm10051|Gm15627_chr5_133683820_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm4922|Perp_chr10_18842008_F | TCGTCGGCAGCGTCCCTCCCACAGGTTGTGTAGAC | 59.9 | 0.19 |
| mm4_intergenic_Gm4922|Perp_chr10_18842008_R | GTCTCGTGGGCTCGGTGACACAACAGCCACTTCCG | 60.8 | 0.19 |
| mm4_intergenic_Cadm2|Gm24681_chr16_68277287_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Cadm2|Gm24681_chr16_68277287_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm23891|1700018B24Rik_chr3_48588074_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Gm23891|1700018B24Rik_chr3_48588074_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_P2ry2|Fchsd2_chr7_101053007_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_P2ry2|Fchsd2_chr7_101053007_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Fto|Gm3235_chr8_91605034_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Fto|Gm3235_chr8_91605034_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Thap1|Gm22227_chr8_26194241_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Thap1|Gm22227_chr8_26194241_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Pla2g5_chr4_138809842_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Pla2g5_chr4_138809842_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_A430057M04Rik|Zfp503_chr14_21956991_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_A430057M04Rik|Zfp503_chr14_21956991_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Slc44a3_chr3_121523277_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Slc44a3_chr3_121523277_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_B130011K05Rik|Gm12287_chr11_63542787_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_B130011K05Rik|Gm12287_chr11_63542787_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm25658|Atp2b1_chr10_97996158_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm25658|Atp2b1_chr10_97996158_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm13535|Gpd2_chr2_57287272_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm13535|Gpd2_chr2_57287272_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Tll1|Mir710_chr8_64443664_F | TCGTCGGCAGCGTCTGAACAGAGCCAGAGAAAGGG | 59.6 | 0.17 |
| mm4_intergenic_Tll1|Mir710_chr8_64443664_R | GTCTCGTGGGCTCGGCATTAGCCCTCTGCCACAGT | 59.7 | 0.17 |
| mm3_intron_MDGA2/Mdga2_chr12_66534564_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm3_intron_MDGA2/Mdga2_chr12_66534564_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm14628|Gm14604_chrX_44103203_F | TCGTCGGCAGCGTCATCAAATGAGTGCCTGCCAC | 58.8 | 0.17 |
| mm4_intergenic_Gm14628|Gm14604_chrX_44103203_R | GTCTCGTGGGCTCGGAGCACTATACAAGAGCAAGCTGT | 60.0 | 0.17 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_83074476_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_83074476_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Gm9996/Soga3|Soga3_chr10_29145352_F | TCGTCGGCAGCGTCACCGCCCTAAAGGAAGACAA | 58.9 | 0.16 |
| mm4_intergenic_Gm9996/Soga3|Soga3_chr10_29145352_R | GTCTCGTGGGCTCGGATGCTCAGACATTCCTATGGAG | 57.3 | 0.16 |
| mm4_intergenic_Gm13683|Gm13685_chr2_83522032_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Gm13683|Gm13685_chr2_83522032_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Zfp873|AU041133_chr10_82071058_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Zfp873|AU041133_chr10_82071058_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_9130204L05Rik|Gm23697_chr3_91743070_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_9130204L05Rik|Gm23697_chr3_91743070_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_9130204L05Rik|Gm23697_chr3_91633141_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_9130204L05Rik|Gm23697_chr3_91633141_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intron_Adamtsl1_chr4_86067120_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intron_Adamtsl1_chr4_86067120_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Gm25598|BC002059_chr17_15855158_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Gm25598|BC002059_chr17_15855158_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Dgkh|Vwa8_chr14_78769833_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Dgkh|Vwa8_chr14_78769833_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intron_Ppp1r13b_chr12_111869947_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intron_Ppp1r13b_chr12_111869947_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Xkr4|Gm1992_chr1_3454981_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Xkr4|Gm1992_chr1_3454981_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Olfr1370|Olfr1369-ps1_chr13_21096411_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Olfr1370|Olfr1369-ps1_chr13_21096411_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Gm6973|4932429P05Rik_chrX_89472948_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Gm6973|4932429P05Rik_chrX_89472948_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intron_Tmem132c_chr5_127443452_F | TCGTCGGCAGCGTCCCAGCCTTCTCTGCTTCTCC | 60.1 | 0.14 |
| mm4_intron_Tmem132c_chr5_127443452_R | GTCTCGTGGGCTCGGTGCTCACTAGACCTCAAGCTC | 59.1 | 0.14 |
| mm4_exon_Usp54/1810062O18Rik_chr14_20561613_F | TCGTCGGCAGCGTCTAGGGCTCCTCACTGCTTCT | 59.9 | 0.14 |
| mm4_exon_Usp54/1810062O18Rik_chr14_20561613_R | GTCTCGTGGGCTCGGCGTCTGCTGCTTCTTCACCT | 60.3 | 0.14 |
| mm4_intergenic_Mbnl1|Gm8325_chr3_60857072_F | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_intergenic_Mbnl1|Gm8325_chr3_60857072_R | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_intergenic_Gm25220|Man1b1_chr2_25341093_F | TCGTCGGCAGCGTCTCTTAGAGCAGCCCTGGAGT | 59.9 | 0.14 |
| mm4_intergenic_Gm25220|Man1b1_chr2_25341093_R | GTCTCGTGGGCTCGGAACAACCACCAGGCAATCCT | 59.8 | 0.14 |
| mm4_intron_Slc12a2_chr18_57928478_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Slc12a2_chr18_57928478_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Gbp9_chr5_105097177_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Gbp9_chr5_105097177_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm2_intron_Mcm9_chr10_53625054_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm2_intron_Mcm9_chr10_53625054_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_E130006D01Rik/Gm16019|E130006D01Rik_chr5_111761351_F | TCGTCGGCAGCGTCCCCCTCCTACCACTCCTCTC | 60.1 | 0.13 |
| mm4_intergenic_E130006D01Rik/Gm16019|E130006D01Rik_chr5_111761351_R | GTCTCGTGGGCTCGGCGGTTGATACACGCTGGTTTG | 60.1 | 0.13 |
| mm4_intron_Zfp932_chr5_110002624_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Zfp932_chr5_110002624_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm15446/Gm26808|Gm15446_chr5_109932207_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm15446/Gm26808|Gm15446_chr5_109932207_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm12183|Gnb2l1/Gm25296/Snord96a/Snord95_chr11_48776517_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm12183|Gnb2l1/Gm25296/Snord96a/Snord95_chr11_48776517_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Fyn_chr10_39470708_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Fyn_chr10_39470708_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_Smarcc1_chr9_110140200_F | TCGTCGGCAGCGTCACTTATTTTCAGAATTGGAGTGCTG | 58.0 | 0.12 |
| mm4_intron_Smarcc1_chr9_110140200_R | GTCTCGTGGGCTCGGCCAACAACTGGTATTTGTTTGTGT | 58.5 | 0.12 |
| mm4_intron_Rspo2_chr15_43070944_F | TCGTCGGCAGCGTCAGGCAATGATGGGTACAGATCT | 58.9 | 0.12 |
| mm4_intron_Rspo2_chr15_43070944_R | GTCTCGTGGGCTCGGAGCCTCAAGACAGTCCTTTCA | 58.9 | 0.12 |
| mm4_intergenic_Gm6317|Gm25383_chr13_78813385_F | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intergenic_Gm6317|Gm25383_chr13_78813385_R | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intron_Lpp_chr16_24977708_F | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intron_Lpp_chr16_24977708_R | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intergenic_Gm7936|Gm24396_chr18_30565078_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm7936|Gm24396_chr18_30565078_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm12016|Etaa1_chr11_17751387_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm12016|Etaa1_chr11_17751387_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm12602|Mtap_chr4_89133299_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm12602|Mtap_chr4_89133299_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Epm2aip1|Trank1_chr9_111303504_F | TCGTCGGCAGCGTCTGGAGGCCTGTGGTCCTG | 60.9 | 0.11 |
| mm4_intergenic_Epm2aip1|Trank1_chr9_111303504_R | GTCTCGTGGGCTCGGACACATACACACACACATGTAAC | 57.3 | 0.11 |
| mm4_intergenic_Dsg4|Dsg3_chr18_20480878_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Dsg4|Dsg3_chr18_20480878_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm3_intergenic_Gm14672|Gm14668_chrX_65567410_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm3_intergenic_Gm14672|Gm14668_chrX_65567410_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_1700123L14Rik|Gm22971_chr6_96187249_F | TCGTCGGCAGCGTCTCAGGTTATTGTGGGTATTGCC | 58.3 | 0.11 |
| mm4_intergenic_1700123L14Rik|Gm22971_chr6_96187249_R | GTCTCGTGGGCTCGGCTCCAAGCTCCTGGCATACC | 60.1 | 0.11 |
| mm4_intergenic_Gm26372|Adk_chr14_21312653_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm26372|Adk_chr14_21312653_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm6098|Zbbx_chr3_74661983_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm6098|Zbbx_chr3_74661983_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm13606|Stk39_chr2_68182085_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm13606|Stk39_chr2_68182085_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm3_intergenic_Cbln2|Gm5096_chr18_87487126_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm3_intergenic_Cbln2|Gm5096_chr18_87487126_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm24374|Sash1_chr10_8717283_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm24374|Sash1_chr10_8717283_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm3_intergenic_C230029F24Rik|PCGEM1_chr1_49920028_F | TCGTCGGCAGCGTCACCCGCACTCCAAAATCCTT | 59.8 | 0.11 |
| mm3_intergenic_C230029F24Rik|PCGEM1_chr1_49920028_R | GTCTCGTGGGCTCGGAGAGCAGAGATGTTGTCAAGGA | 59.0 | 0.11 |
| mm4_intergenic_Lyzl6|Rprml_chr11_103644197_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Lyzl6|Rprml_chr11_103644197_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intron_Prkg1_chr19_30857735_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intron_Prkg1_chr19_30857735_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm25214|Zfp64_chr2_168882967_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm25214|Zfp64_chr2_168882967_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm25384|Cxcr4_chr1_128515646_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm25384|Cxcr4_chr1_128515646_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intron_Pax7_chr4_139827793_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intron_Pax7_chr4_139827793_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Alcam|Gm25723_chr16_52596587_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Alcam|Gm25723_chr16_52596587_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm22797|Robo1_chr16_71746523_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm22797|Robo1_chr16_71746523_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r91|Gm16442_chr7_20114864_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r91|Gm16442_chr7_20114864_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r160|Gm4214_chr7_22967689_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r160|Gm4214_chr7_22967689_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r157|Vmn1r158_chr7_22783069_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r157|Vmn1r158_chr7_22783069_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r148|Vmn1r149_chr7_22430521_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r148|Vmn1r149_chr7_22430521_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r139|Gm16451_chr7_22110530_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r139|Gm16451_chr7_22110530_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r132|Gm4175_chr7_21744491_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r132|Gm4175_chr7_21744491_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r125|Vmn1r126_chr7_21284312_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r125|Vmn1r126_chr7_21284312_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r118|Vmn1r119_chr7_21004730_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r118|Vmn1r119_chr7_21004730_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r113|Vmn1r114_chr7_20794992_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r113|Vmn1r114_chr7_20794992_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r100|Vmn1r101_chr7_20434885_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Vmn1r100|Vmn1r101_chr7_20434885_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm4558|Gm4187_chr7_22321992_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm4558|Gm4187_chr7_22321992_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm4498|Gm4133_chr7_20326340_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Gm4498|Gm4133_chr7_20326340_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_n-R5s50|Gm23242_chr14_110381877_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_n-R5s50|Gm23242_chr14_110381877_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Lphn3|Mir1187_chr5_82546862_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Lphn3|Mir1187_chr5_82546862_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm23679|Gm8036_chrX_137174119_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm23679|Gm8036_chrX_137174119_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm11800|Car8_chr4_8133050_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm11800|Car8_chr4_8133050_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Mup21|Zfp37_chr4_62179106_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Mup21|Zfp37_chr4_62179106_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Siglec1|Hspa12b_chr2_131106106_F | TCGTCGGCAGCGTCGGTCTCTCTTCAGCACTCGG | 59.8 | 0.09 |
| mm4_intergenic_Siglec1|Hspa12b_chr2_131106106_R | GTCTCGTGGGCTCGGGTCTGAGTGAGTCTGCAGGG | 59.7 | 0.09 |
| mm4_intergenic_Whrn|Atp6v1g1_chr4_63533245_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Whrn|Atp6v1g1_chr4_63533245_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Zeb1|Arhgap12_chr18_5782729_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Zeb1|Arhgap12_chr18_5782729_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm23733|6530403H02Rik_chr3_120460410_F | TCGTCGGCAGCGTCACTTGACAACAACAGCCCTGA | 60.0 | 0.09 |
| mm4_intergenic_Gm23733|6530403H02Rik_chr3_120460410_R | GTCTCGTGGGCTCGGTGGAGCAAAGCATTGGCAAT | 59.0 | 0.09 |
| mm4_intergenic_Hace1|AC121988.1_chr10_45735585_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Hace1|AC121988.1_chr10_45735585_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm16685|Gm24614_chr3_7701863_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm16685|Gm24614_chr3_7701863_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm8793|Nkain2_chr10_31736924_F | TCGTCGGCAGCGTCCCCCTCTCTCTGTCACACAC | 59.3 | 0.09 |
| mm4_intergenic_Gm8793|Nkain2_chr10_31736924_R | GTCTCGTGGGCTCGGTTTCCTGAGTGCTGTCAACC | 58.0 | 0.09 |
| mm3_intergenic_Msx1|Stx18_chr5_38003946_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm3_intergenic_Msx1|Stx18_chr5_38003946_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Ttc6|Sstr1_chr12_57847155_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Ttc6|Sstr1_chr12_57847155_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_exon_Ttc28_chr5_111287816_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_exon_Ttc28_chr5_111287816_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Cyth1_chr11_118183012_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Cyth1_chr11_118183012_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps23|Gm5167_chrX_123788284_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps23|Gm5167_chrX_123788284_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps22|Gm6604_chrX_123576379_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps22|Gm6604_chrX_123576379_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps21|Astx2_chrX_123346857_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps21|Astx2_chrX_123346857_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps20|Vmn2r121_chrX_124016090_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Rps12-ps20|Vmn2r121_chrX_124016090_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_exon_Gm14957_chrX_126170911_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_exon_Gm14957_chrX_126170911_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_exon_3110007F17Rik_chrX_123117546_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_exon_3110007F17Rik_chrX_123117546_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm25347|S1pr1_chr3_115589602_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm25347|S1pr1_chr3_115589602_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Cdh7|Cdh19_chr1_110478210_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Cdh7|Cdh19_chr1_110478210_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_Gm22074|Pkia_chr3_7067587_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_Gm22074|Pkia_chr3_7067587_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Slc22a23|Pxdc1_chr13_34378610_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Slc22a23|Pxdc1_chr13_34378610_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_Igkv10-95|Igkv10-94_chr6_68687183_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_Igkv10-95|Igkv10-94_chr6_68687183_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm13903|Kcna4_chr2_107172097_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm13903|Kcna4_chr2_107172097_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Ttc17_chr2_94363390_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Ttc17_chr2_94363390_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm13481|Gm13471_chr2_48130769_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm13481|Gm13471_chr2_48130769_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_A330008L17Rik|Gm15680_chr8_99460240_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm3_intergenic_A330008L17Rik|Gm15680_chr8_99460240_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Srp68_chr11_116253572_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Srp68_chr11_116253572_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Gm5483_chr16_36185828_F | TCGTCGGCAGCGTCGGGAGGCAGAGAAACAGACA | 59.3 | 0.08 |
| mm4_intron_Gm5483_chr16_36185828_R | GTCTCGTGGGCTCGGTCCTGACTTAACAAGGGATTTCCA | 59.6 | 0.08 |
| mm4_intergenic_Gm23069|Gm5724_chr6_141722986_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm23069|Gm5724_chr6_141722986_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Commd1/RP23-242C19.7|Cct4_chr11_22990125_F | TCGTCGGCAGCGTCTTCACACTTTGCTCAGCAGA | 57.6 | 0.08 |
| mm4_intergenic_Commd1/RP23-242C19.7|Cct4_chr11_22990125_R | GTCTCGTGGGCTCGGGGCGGTGACTGCCTATCAAA | 60.3 | 0.08 |
| mm4_intergenic_Fmn1|Grem1_chr2_113743361_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Fmn1|Grem1_chr2_113743361_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm8185|Mctp1_chr13_77014766_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm8185|Mctp1_chr13_77014766_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Zfp169_chr13_48491789_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Zfp169_chr13_48491789_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_A630012P03Rik|Gpc3_chrX_52603494_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_A630012P03Rik|Gpc3_chrX_52603494_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Oca2_chr7_56249257_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Oca2_chr7_56249257_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm25437|Gm22684_chr19_19773578_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm25437|Gm22684_chr19_19773578_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Tspan9_chr6_128138512_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Tspan9_chr6_128138512_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm26535|Gm24710_chr10_37586785_F | TCGTCGGCAGCGTCCCCTTCACAGTTTGAACATGTCA | 59.3 | 0.07 |
| mm4_intergenic_Gm26535|Gm24710_chr10_37586785_R | GTCTCGTGGGCTCGGACTCATATATTCTGTTACCCCTGGT | 58.8 | 0.07 |
| mm4_intergenic_Ttc37|Gm24025_chr13_76220608_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Ttc37|Gm24025_chr13_76220608_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm10222|Lmbrd1_chr1_24646363_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm10222|Lmbrd1_chr1_24646363_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm3_intergenic_Gm25383|Gm24863_chr13_79449662_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm3_intergenic_Gm25383|Gm24863_chr13_79449662_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Rgs7_chr1_175269592_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Rgs7_chr1_175269592_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Gm11884_chr4_23265413_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Gm11884_chr4_23265413_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Gbp9_chr5_105098907_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Gbp9_chr5_105098907_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gbp4/Gbp8/Gbp9|Gbp10_chr5_105177682_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gbp4/Gbp8/Gbp9|Gbp10_chr5_105177682_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm15116|Olfr589_chr7_103150760_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm15116|Olfr589_chr7_103150760_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Rasgrf2_chr13_91996451_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Rasgrf2_chr13_91996451_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Abhd4|Olfr49_chr14_54280747_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Abhd4|Olfr49_chr14_54280747_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Cacna2d3_chr14_28941001_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Cacna2d3_chr14_28941001_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Tmem141|Fcna_chr2_25624499_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Tmem141|Fcna_chr2_25624499_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Impg2_chr16_56264840_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Impg2_chr16_56264840_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Ins1|Xpnpep1_chr19_52636103_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Ins1|Xpnpep1_chr19_52636103_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Arpp21_chr9_112095394_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Arpp21_chr9_112095394_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm3_intron_Dzip1l_chr9_99664469_F | TCGTCGGCAGCGTCGACTCCGAGATGCTGCTTCA | 59.8 | 0.06 |
| mm3_intron_Dzip1l_chr9_99664469_R | GTCTCGTGGGCTCGGCCAGCTCCATCATCTTGCCA | 60.1 | 0.06 |
| mm4_intergenic_Col5a2|Gm23216_chr1_45571463_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Col5a2|Gm23216_chr1_45571463_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Gm6931|Ift57_chr16_49559451_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Gm6931|Ift57_chr16_49559451_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Lphn3_chr5_81636248_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Lphn3_chr5_81636248_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Fam174a|Gm15427_chr1_95353714_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Fam174a|Gm15427_chr1_95353714_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Shroom4|Dgkk_chrX_6755767_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Shroom4|Dgkk_chrX_6755767_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Zfp326|Gm25672_chr5_106065763_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Zfp326|Gm25672_chr5_106065763_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Zzef1_chr11_72854763_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Zzef1_chr11_72854763_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Tcf20_chr15_82823206_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Tcf20_chr15_82823206_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Edem1|Gm20387_chr6_108969163_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Edem1|Gm20387_chr6_108969163_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm14674|4930447F04Rik_chrX_66181677_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm14674|4930447F04Rik_chrX_66181677_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm22536|Gm6632_chr5_58773960_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm22536|Gm6632_chr5_58773960_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Plcg1_chr2_160754016_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Plcg1_chr2_160754016_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Xirp2|mmu-mir-7224_chr2_67593627_F | TCGTCGGCAGCGTCTCAAGGTTTACCCCACAGCC | 59.8 | 0.05 |
| mm4_intergenic_Xirp2|mmu-mir-7224_chr2_67593627_R | GTCTCGTGGGCTCGGTGCAGGAGAGATGAAAGTGCT | 59.3 | 0.05 |
| mm4_intergenic_1700018B24Rik|Gm23511_chr3_48785729_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_1700018B24Rik|Gm23511_chr3_48785729_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Tsc2_chr17_24598900_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Tsc2_chr17_24598900_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Cntnap4|Gm25766_chr8_113090977_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Cntnap4|Gm25766_chr8_113090977_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Slc47a2_chr11_61315562_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Slc47a2_chr11_61315562_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Rims1_chr1_22564456_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Rims1_chr1_22564456_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Vmn1r176|Vmn1r177_chr7_23862194_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Vmn1r176|Vmn1r177_chr7_23862194_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Oxgr1|Mbnl2_chr14_120217826_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Oxgr1|Mbnl2_chr14_120217826_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm3_intergenic_Trpc7|Gm22777_chr13_56925826_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm3_intergenic_Trpc7|Gm22777_chr13_56925826_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm3_intergenic_Gm25722|Gm10051_chr5_133067034_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm3_intergenic_Gm25722|Gm10051_chr5_133067034_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Olfr571|Olfr572_chr7_102922753_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Olfr571|Olfr572_chr7_102922753_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm24078|1700025O08Rik_chr4_22888337_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm24078|1700025O08Rik_chr4_22888337_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Diablo|Vps33a_chr5_123527496_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Diablo|Vps33a_chr5_123527496_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Ppl_chr16_5091224_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Ppl_chr16_5091224_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Spred2_chr11_19958043_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Spred2_chr11_19958043_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm23385|Gm7803_chrX_50128244_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm23385|Gm7803_chrX_50128244_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Fut8|Gm24070_chr12_77600201_F | TCGTCGGCAGCGTCCAGCAGTGCCATTTCCGTG | 59.7 | 0.04 |
| mm4_intergenic_Fut8|Gm24070_chr12_77600201_R | GTCTCGTGGGCTCGGGGCAAGTACGGTGAGACCTT | 59.6 | 0.04 |
| mm4_intergenic_Hdx|Gm14898_chrX_111729216_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Hdx|Gm14898_chrX_111729216_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm20594|Gm4409_chr6_79835847_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm20594|Gm4409_chr6_79835847_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm7731|Gm21897_chr16_15243153_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm7731|Gm21897_chr16_15243153_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm14806|Amer1_chrX_95419256_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm14806|Amer1_chrX_95419256_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm22797|Robo1_chr16_72224921_F | TCGTCGGCAGCGTCGGATTCCTCTCCCTCCTGGT | 60.0 | 0.04 |
| mm4_intergenic_Gm22797|Robo1_chr16_72224921_R | GTCTCGTGGGCTCGGGAGAGAAGCCCTGTGTCCAG | 59.7 | 0.04 |
| mm4_intergenic_Gm6614|Slco1a6_chr6_142016744_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm6614|Slco1a6_chr6_142016744_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Slc7a11_chr3_50397328_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Slc7a11_chr3_50397328_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Pikfyve_chr1_65239793_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Pikfyve_chr1_65239793_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Tro|Gm15132_chrX_150660954_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Tro|Gm15132_chrX_150660954_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Rnf180|Htr1a_chr13_105302850_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Rnf180|Htr1a_chr13_105302850_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Mbnl1|Gm8325_chr3_60678624_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Mbnl1|Gm8325_chr3_60678624_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25495|Gm23225_chr14_90737236_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25495|Gm23225_chr14_90737236_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm10295|Mctp2_chr7_71925052_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm10295|Mctp2_chr7_71925052_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm22507|Trhde_chr10_113810760_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm22507|Trhde_chr10_113810760_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Prdm4|Ascl4_chr10_85917790_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Prdm4|Ascl4_chr10_85917790_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25976|Acot10_chr15_20538751_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25976|Acot10_chr15_20538751_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_D430042O09Rik_chr7_125819485_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_D430042O09Rik_chr7_125819485_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Hace1_chr10_45655126_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Hace1_chr10_45655126_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Mtif3|Lnx2_chr5_146968897_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Mtif3|Lnx2_chr5_146968897_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm22682|Col25a1_chr3_130284385_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm22682|Col25a1_chr3_130284385_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25578|Actr3_chr1_124942938_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25578|Actr3_chr1_124942938_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Tbcd_chr11_121469345_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Tbcd_chr11_121469345_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Fam19a1|Fam19a4_chr6_96681210_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Fam19a1|Fam19a4_chr6_96681210_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Tktl2|Gm16330_chr8_66547552_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Tktl2|Gm16330_chr8_66547552_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25656|Cntn6_chr6_103962240_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25656|Cntn6_chr6_103962240_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_BC016423_chr13_3585741_F | TCGTCGGCAGCGTCACTGCAAAAGAGGCAATTTCCT | 59.0 | 0.04 |
| mm4_intron_BC016423_chr13_3585741_R | GTCTCGTGGGCTCGGTGCCCTTTTGTAGGCAGGTT | 59.8 | 0.04 |
| mm4_intron_Pid1_chr1_84183989_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Pid1_chr1_84183989_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Glrx3|Gm25798_chr7_137672171_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Glrx3|Gm25798_chr7_137672171_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Pfdn4|Gm14637_chr2_170521431_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Pfdn4|Gm14637_chr2_170521431_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm5766|Adcy9_chr16_4237614_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm5766|Adcy9_chr16_4237614_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Tmem178b_chr6_39962742_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Tmem178b_chr6_39962742_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Macrod2_chr2_140785757_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Macrod2_chr2_140785757_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Zkscan2|Gm23788_chr7_123625280_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Zkscan2|Gm23788_chr7_123625280_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Twistnb|Gm23529_chr12_33440052_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Twistnb|Gm23529_chr12_33440052_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Sorcs3|AC116451.1_chr19_49234136_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Sorcs3|AC116451.1_chr19_49234136_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Il12rb2|Gm4761_chr6_67381183_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Il12rb2|Gm4761_chr6_67381183_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gpr165|Gm16394_chrX_96794009_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gpr165|Gm16394_chrX_96794009_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gpr158|Gm13337_chr2_22007413_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gpr158|Gm13337_chr2_22007413_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8978|Gm8980_chr19_33672042_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8978|Gm8980_chr19_33672042_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8084|Gm15390_chr1_107250248_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8084|Gm15390_chr1_107250248_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_82642657_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_82642657_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm5519|Gm8988_chr19_33838281_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm5519|Gm8988_chr19_33838281_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25985|Gm6404_chr13_116153224_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25985|Gm6404_chr13_116153224_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm24635|Arrdc3_chr13_80608594_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm24635|Arrdc3_chr13_80608594_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm22848|Rp1_chr1_3944991_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm22848|Rp1_chr1_3944991_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm22338|Tank_chr2_61505430_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm22338|Tank_chr2_61505430_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm13794|Gm13796_chr2_95469045_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm13794|Gm13796_chr2_95469045_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm11925|Gm11924_chr4_30286000_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm11925|Gm11924_chr4_30286000_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Foxo1|Gm10293_chr3_52424288_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Foxo1|Gm10293_chr3_52424288_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Fads2|Fads1_chr19_10154147_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Fads2|Fads1_chr19_10154147_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Wwox_chr8_115205927_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Wwox_chr8_115205927_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cacna1i_chr15_80316758_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cacna1i_chr15_80316758_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Pde4b_chr4_102452986_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Pde4b_chr4_102452986_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Katnbl1|Emc7_chr2_112426492_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Katnbl1|Emc7_chr2_112426492_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Grid1|4930596D02Rik_chr14_35750805_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Grid1|4930596D02Rik_chr14_35750805_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8061|D330045A20Rik_chrX_139430123_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm8061|D330045A20Rik_chrX_139430123_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25011|Gm23680_chr10_12322061_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25011|Gm23680_chr10_12322061_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm24262|Dcps_chr9_35153498_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm24262|Dcps_chr9_35153498_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Aff2|1700020N15Rik_chrX_69873922_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Aff2|1700020N15Rik_chrX_69873922_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Rpp40|Ppp1r3g_chr13_35907651_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Rpp40|Ppp1r3g_chr13_35907651_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Mug1_chr6_121844045_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Mug1_chr6_121844045_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cdc42bpa_chr1_180015183_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cdc42bpa_chr1_180015183_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Catsperb_chr12_101538729_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Catsperb_chr12_101538729_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm3_intergenic_C1galt1c1|Ap3s1-ps1_chrX_38673916_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm3_intergenic_C1galt1c1|Ap3s1-ps1_chrX_38673916_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25886|Gm25415_chr14_89565820_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm25886|Gm25415_chr14_89565820_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120240785_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Pla2g4e|Pla2g4e/Gm13997_chr2_120240785_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Eml1_chr12_108375486_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Eml1_chr12_108375486_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Prkg2|Rasgef1b_chr5_99048623_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Prkg2|Rasgef1b_chr5_99048623_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Tbc1d5_chr17_50748931_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Tbc1d5_chr17_50748931_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22797|Robo1_chr16_72177995_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22797|Robo1_chr16_72177995_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Ano6_chr15_95895215_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Ano6_chr15_95895215_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Pde1a_chr2_79925338_F | TCGTCGGCAGCGTCTGACTTGAGGACCATGGAGA | 57.6 | 0.02 |
| mm4_intron_Pde1a_chr2_79925338_R | GTCTCGTGGGCTCGGTGCCTGGATGTTCAAACTTTGA | 58.7 | 0.02 |
| mm4_intergenic_Gm25976|Acot10_chr15_20378919_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25976|Acot10_chr15_20378919_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25442|Gm25696_chr3_35534176_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25442|Gm25696_chr3_35534176_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm3_intergenic_Gpr149|Gm22433_chr3_62861367_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm3_intergenic_Gpr149|Gm22433_chr3_62861367_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24104|Gm26058_chr6_10448897_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24104|Gm26058_chr6_10448897_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm3_intergenic_Fam173b|Tas2r119_chr15_32119259_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm3_intergenic_Fam173b|Tas2r119_chr15_32119259_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24246|Pik3c3_chr18_28936698_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24246|Pik3c3_chr18_28936698_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12129|Gm12130_chr11_38309370_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12129|Gm12130_chr11_38309370_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Hnf1b_chr11_83898427_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Hnf1b_chr11_83898427_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Dkk2_chr3_132125543_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Dkk2_chr3_132125543_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12020|Gm12022_chr11_18353003_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12020|Gm12022_chr11_18353003_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Eif3s6-ps1|Gm11995_chr11_9912176_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Eif3s6-ps1|Gm11995_chr11_9912176_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Xrcc4_chr13_90088209_F | TCGTCGGCAGCGTCTCTTTACTAGAGCCTGGACCAGA | 59.9 | 0.02 |
| mm4_intron_Xrcc4_chr13_90088209_R | GTCTCGTGGGCTCGGTGCTAGGTCCTACTGTTTGACAC | 59.9 | 0.02 |
| mm4_intergenic_Zic4|Gm26101_chr9_91596522_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Zic4|Gm26101_chr9_91596522_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Sntb1|Has2_chr15_56652269_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Sntb1|Has2_chr15_56652269_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7481|Prkd1_chr12_50209246_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7481|Prkd1_chr12_50209246_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26825/Gm15459|Gm23838_chr5_5862523_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26825/Gm15459|Gm23838_chr5_5862523_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cenpf|Ptpn14_chr1_189720956_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cenpf|Ptpn14_chr1_189720956_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_exon_Gm26577/Myb_chr10_21146143_F | TCGTCGGCAGCGTCAGGACCAAACCGTATTTGCT | 57.4 | 0.02 |
| mm4_exon_Gm26577/Myb_chr10_21146143_R | GTCTCGTGGGCTCGGAGAATTTGCAGAAACACTCCAGT | 58.7 | 0.02 |
| mm4_intron_Prkar1b_chr5_139023125_F | TCGTCGGCAGCGTCGCATGCGCACACATTCCC | 60.2 | 0.02 |
| mm4_intron_Prkar1b_chr5_139023125_R | GTCTCGTGGGCTCGGGTAAGTGCTAGGGCTCAGGC | 60.1 | 0.02 |
| mm4_intron_Fbxo47_chr11_97872295_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Fbxo47_chr11_97872295_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rprml|Gosr2_chr11_103658379_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rprml|Gosr2_chr11_103658379_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Lrriq4_chr3_30660478_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Lrriq4_chr3_30660478_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Immp2l_chr12_41680847_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Immp2l_chr12_41680847_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Abcc9_chr6_142622115_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Abcc9_chr6_142622115_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc7a11|Gm24503_chr3_50649192_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc7a11|Gm24503_chr3_50649192_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ret|Bms1_chr6_118227115_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ret|Bms1_chr6_118227115_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26913|Gm4076_chr13_85108637_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26913|Gm4076_chr13_85108637_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25977|Gm11875_chr4_21575976_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25977|Gm11875_chr4_21575976_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25579|Cln3_chr7_126570268_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25579|Cln3_chr7_126570268_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24632|Lyzl1_chr18_4104722_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24632|Lyzl1_chr18_4104722_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22963|Prex2_chr1_10931075_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22963|Prex2_chr1_10931075_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm15131|Maged2_chrX_150796841_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm15131|Maged2_chrX_150796841_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13313|Gm13367_chr2_15215882_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13313|Gm13367_chr2_15215882_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdr1|Gm14665_chrX_61229589_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdr1|Gm14665_chrX_61229589_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_A930038B10Rik|Grid1_chr14_34808248_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_A930038B10Rik|Grid1_chr14_34808248_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22536|Gm6632_chr5_58459407_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22536|Gm6632_chr5_58459407_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_exon_Itpr2_chr6_146159013_F | TCGTCGGCAGCGTCTGGTTCAGCACGGTGACAAT | 60.1 | 0.01 |
| mm4_exon_Itpr2_chr6_146159013_R | GTCTCGTGGGCTCGGCCGATGTTCACAATGGTGCG | 60.1 | 0.01 |
| mm3_intergenic_Mrgprb2|Mrgprb3_chr7_48591243_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm3_intergenic_Mrgprb2|Mrgprb3_chr7_48591243_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Gm12002_chr11_12346520_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Gm12002_chr11_12346520_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Atg4d_chr9_21272135_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Atg4d_chr9_21272135_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22527|Rnf144a_chr12_25934936_F | TCGTCGGCAGCGTCTTTCAAACTGGTGGCCCACA | 60.3 | 0.01 |
| mm4_intergenic_Gm22527|Rnf144a_chr12_25934936_R | GTCTCGTGGGCTCGGCTGGAGTTGGCAGGTCTGAC | 60.3 | 0.01 |
| mm4_intergenic_Dgkg|Crygs_chr16_22756674_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Dgkg|Crygs_chr16_22756674_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cers4|Zfp958_chr8_4596940_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cers4|Zfp958_chr8_4596940_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Arsg_chr11_109535151_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Arsg_chr11_109535151_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_5730455P16Rik_chr11_80373744_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_5730455P16Rik_chr11_80373744_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Zfp280c_chrX_48569532_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Zfp280c_chrX_48569532_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm15005|Gm15004_chrX_136579234_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm15005|Gm15004_chrX_136579234_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm3_intergenic_Gm13468|Gm13481_chr2_48004952_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm3_intergenic_Gm13468|Gm13481_chr2_48004952_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Klhdc1_chr12_69243256_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Klhdc1_chr12_69243256_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_AC135509.1|Gm22386_chr17_82228024_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_AC135509.1|Gm22386_chr17_82228024_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ctnnd2_chr15_30810352_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ctnnd2_chr15_30810352_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Nrxn3_chr12_89002247_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Nrxn3_chr12_89002247_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Pde1c_chr6_56116772_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Pde1c_chr6_56116772_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm5973|Gm9915_chr1_41933595_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm5973|Gm9915_chr1_41933595_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Ush2a_chr1_188308150_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Ush2a_chr1_188308150_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Tnik_chr3_28641786_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Tnik_chr3_28641786_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Slc9a4_chr1_40584331_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Slc9a4_chr1_40584331_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Rbms3_chr9_116723199_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Rbms3_chr9_116723199_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Polr3b_chr10_84652298_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Polr3b_chr10_84652298_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Nol10_chr12_17369160_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Nol10_chr12_17369160_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Kcnq1_chr7_143171629_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Kcnq1_chr7_143171629_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gpn3_chr5_122374146_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gpn3_chr5_122374146_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gipc2_chr3_152104485_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gipc2_chr3_152104485_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Dis3l2_chr1_86958419_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Dis3l2_chr1_86958419_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cyp3a41b_chr5_145582228_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cyp3a41b_chr5_145582228_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cyp3a41a_chr5_145717638_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cyp3a41a_chr5_145717638_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cntn4_chr6_105866519_F | TCGTCGGCAGCGTCACAGGTGGATGGAATGAAGTGT | 59.6 | 0.00 |
| mm4_intron_Cntn4_chr6_105866519_R | GTCTCGTGGGCTCGGACTTGTTGGGTAGCTGGGTT | 59.1 | 0.00 |
| mm4_intron_Cacna1c_chr6_118601728_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cacna1c_chr6_118601728_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ybx3|Gm6619/5430401F13Rik_chr6_131417941_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ybx3|Gm6619/5430401F13Rik_chr6_131417941_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Slco5a1|Gm5250_chr1_13028208_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Slco5a1|Gm5250_chr1_13028208_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_RP23-131O4.2|Gm23470_chr14_48917811_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_RP23-131O4.2|Gm23470_chr14_48917811_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Otud3|Rnf186_chr4_138918011_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Otud3|Rnf186_chr4_138918011_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Oaz1-ps|Riok2_chr17_17357947_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Oaz1-ps|Riok2_chr17_17357947_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Myo9a|Gm7613_chr9_59764330_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Myo9a|Gm7613_chr9_59764330_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Mycn|Gm24208_chr12_12991204_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Mycn|Gm24208_chr12_12991204_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Mir3072/Mirg|Dio3os_chr12_110063865_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Mir3072/Mirg|Dio3os_chr12_110063865_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Lrrc4c|Gm13803_chr2_97825129_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Lrrc4c|Gm13803_chr2_97825129_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Lcorl|Gm7931_chr5_46259575_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Lcorl|Gm7931_chr5_46259575_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Hs3st4/Gm27040|Gm25759_chr7_124124593_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Hs3st4/Gm27040|Gm25759_chr7_124124593_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gpr81|Denr_chr5_123885017_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gpr81|Denr_chr5_123885017_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_82855198_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_82855198_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm26171|Fam49a_chr12_12232820_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm26171|Fam49a_chr12_12232820_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm26107|Emcn_chr3_137289719_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm26107|Emcn_chr3_137289719_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm24697|Gm11404_chr4_69288116_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm24697|Gm11404_chr4_69288116_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21614|Gm23249_chr12_93206102_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21614|Gm23249_chr12_93206102_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm14899|Tex16_chrX_111949726_F | TCGTCGGCAGCGTCACATAGGTGAGTGCACATGC | 58.2 | 0.00 |
| mm4_intergenic_Gm14899|Tex16_chrX_111949726_R | GTCTCGTGGGCTCGGACACCACAACCAATACAACACTG | 59.6 | 0.00 |
| mm4_intergenic_Gm12295|Gm26128_chr11_65486888_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm12295|Gm26128_chr11_65486888_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Dpyd|Gm23432_chr3_119614812_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Dpyd|Gm23432_chr3_119614812_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cyp51|Gm9897_chr5_4157583_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cyp51|Gm9897_chr5_4157583_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cyp3a41b|Cyp3a41a_chr5_145645373_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cyp3a41b|Cyp3a41a_chr5_145645373_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ccdc172|Pnlip_chr19_58599103_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ccdc172|Pnlip_chr19_58599103_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cadm2|Gm15828_chr16_67119752_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cadm2|Gm15828_chr16_67119752_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Btd|Ankrd28_chr14_31686532_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Btd|Ankrd28_chr14_31686532_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Bmper|Npsr1_chr9_23863628_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Bmper|Npsr1_chr9_23863628_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Bloc1s5|Eef1e1_chr13_38644497_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Bloc1s5|Eef1e1_chr13_38644497_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ahctf1/Gm10518|Cdc42bpa_chr1_179826979_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ahctf1/Gm10518|Cdc42bpa_chr1_179826979_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_5730507C01Rik|Gm3944_chr12_18744242_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_5730507C01Rik|Gm3944_chr12_18744242_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_4631405K08Rik|Plxna2_chr1_194565259_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_4631405K08Rik|Plxna2_chr1_194565259_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Slc35e2_chr4_155620832_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Slc35e2_chr4_155620832_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Adamtsl2_chr2_27100776_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Adamtsl2_chr2_27100776_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm3_intergenic_Far1|Far1/1700006P19Rik_chr7_113547719_F | TCGTCGGCAGCGTCACTCTGCATATCCTCTGCCA | 58.2 | 0.00 |
| mm3_intergenic_Far1|Far1/1700006P19Rik_chr7_113547719_R | GTCTCGTGGGCTCGGACCAAGCCTCTAACACATGGA | 59.0 | 0.00 |
| mm3_exon_Gm20667_chr14_67673313_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm3_exon_Gm20667_chr14_67673313_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm2_intergenic_Nudcd3|Rps15a-ps6_chr11_6164272_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm2_intergenic_Nudcd3|Rps15a-ps6_chr11_6164272_R | Primer3: not found at this Tm | N.d. | 0.00 |
These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313861 |
AGGGAGCCTGGGATTAGGAGCTTACTTGGGGGTTTTCCCCCTCCCCCCCTCTGGAGAGTCCGGGGATGGAGAGCCGAAAG GACATGGTTATGTTTCTGGATGGGGGTCAGCTTGGCACTCTGGTTGGTA |
| mm4_intron_AC132444.1_chr1_GL456221_random_20397 |
CTTCTGACCTCCAGTGCCACCCACAAAGTAAACAGAAGGCACACAGACAATTGACCAAAAGTCTGAAAGAGCCTTGAAGA GAAGTCCCTGGGGCAAGCCACATCCAGAGACCTATCTATGCTCCTGCCCCTGGACTGG |
| mm4_intergenic_Gap|AC133103.4_chr1_GL456211_random_20413 |
CTTCTGACCTCCAGTGCCACCCACAAAGTAAACAGAAGGCACACAGACAATTGACCAAAAGTCTGAAAGAGCCTTGAAGA GAAGTCCCTGGGGCAAGCCACATCCAGAGACCTATCTATGCTCCTGCCCCTGGACTGG |
| mm4_intergenic_Gm12666|Gm12638_chr4_92366492 | ACATGGCAGGAATGACTGATTCCATGAATATATTTCAGGATGTGGGAAGCCAGAGGAACACAGGCTTT |
| mm4_intergenic_Gm6806|Gm22332_chrX_68545507 |
ACTTTAATCCCTTCTGAGAGGAGACCCCAACCAGTGACATAACCATATTCTATTAGATTCTATCAACACTTGACATCATC AAGCTGAAGTTTAGGTTTCTAAGACATGAAATCTTGTAAGCAACCTGT |
| mm4_intergenic_4930470P17Rik|Gm14264_chr2_170643378 |
AATGAAGGAGCCAGGATGCCTGGGGAAAACGAATGCTCCTTAAATCCTCATCTAGAACCACATCCATGACGTACCTGCAA GCTGAACCACAGAGT |
| mm3_exon_Nudt12_chr17_59002284 |
AGAATGCTTGCTGCTTCCCTTTGGTAAGAACGTCCACAACCTGAAACACAACCATGATAGAACACATTAGAGGGCCAGCT |
| mm3_intergenic_Gm23240|Gm8357_chr1_48540336 |
AAATAATATGACTTAAGGCACACGTATAATTAAAATTGTTTCTTGCCATAGCATTTGCTTATTCTTTTTCTTGGAGGGTC ATGGTTAGTGTTCTGGATGTGGAAATCGTTCTGAAACTTAAATAGGATGTGCAG |
| mm3_intergenic_Slc1a3|Gm5210_chr15_8741318 |
ACGATGTGTGTGGAGACATGTAGTGACCACTAGAGCATGAGTATGGTTCTGGATGAGGGAAGATAGGAGCTGACCTCTTA AAGAACTGACCTCCCGGCAGGCTTTCTGAGGAAGAACCTGGCAGCTGTCATGGATTGT |
| mm4_intergenic_Gm4922|Perp_chr10_18842008 |
CCTCCCACAGGTTGTGTAGACAGAGTCCCACCATTAGTTAGATTTCTACTTCCTGAATACTCCAAAGGCCACAGGCAGCC AGGACAGAATTATGTGTCTGGATGGGGCAGGGGAGCGGAAGTGGCTGTTGTGTCA |
| mm4_intergenic_Tll1|Mir710_chr8_64443664 |
TGAACAGAGCCAGAGAAAGGGCAGCATGGTAGTGTCTCTGGAAGAGGAAAGGTAGGAATATCCACAGGGAAATTTTTGAA TCAAACCTATTTTACCTCTTTATTTTGACTATCTGATAGGACTGTGGCAGAGGGCTAATG |
| mm4_intergenic_Gm14628|Gm14604_chrX_44103203 |
ATCAAATGAGTGCCTGCCACTTCTTCACCAAATCCAAAAACAGAACCAGGATTTGCACATTCACCATGTACTTTCAGAGC TTCTAATTACAGCTTGCTCTTGTATAGTGCT |
| mm4_intergenic_Gm9996/Soga3|Soga3_chr10_29145352 |
ACCGCCCTAAAGGAAGACAAACAGCCTTTTGGTTAAATAGTGTTCCATGGTTCTGTTTCAGAATTTGGCTCCATAGGAAT GTCTGAGCAT |
| mm4_intron_Tmem132c_chr5_127443452 |
CCAGCCTTCTCTGCTTCTCCATCCACTAGCCAGTAGTTATGCTGCCTCCCCTGTGACTGGGACATGGGTATGTTTCTAGA CATGGGAAAGAGCTTGAGGTCTAGTGAGCA |
| mm4_exon_Usp54/1810062O18Rik_chr14_20561613 |
TAGGGCTCCTCACTGCTTCTGACCACTTTTGAAGTCAATGAAGTCTGGAGACTTTGGGCTTGAACGTGTTGGTTAAGTTT CTGCATGGGGTCAGCAGCATGAAGCACAGGTGAAGAAGCAGCAGACG |
| mm4_intergenic_Gm25220|Man1b1_chr2_25341093 |
TCTTAGAGCAGCCCTGGAGTTATCTCCTCCACACCGAGATGGCCATATCCAGAAAGAGTACCATGTCTCAAATAGTGTGA TATATGTCAGGATTGCCTGGTGGTTGTT |
| mm4_intergenic_E130006D01Rik/Gm16019|E130006D01Rik_chr5_111761351 |
CCCCTCCTACCACTCCTCTCACTGGTTCTTGGCTATTTTTCTGGAGGGGGCGGTCACCGATCCTTCCCCCCATATCCCAG ACCTTCACACCTTAAATGACAAACCAGCGTGTATCAACCG |
| mm4_intron_Smarcc1_chr9_110140200 |
ACTTATTTTCAGAATTGGAGTGCTGAGAGGTTTATATTTCTGGATGTGGCAAAATTTCTTTTTTTTTCTTTAATGAACTA TTTCTAATAAAATAGCCTTTGTAACACAAACAAATACCAGTTGTTGG |
| mm4_intron_Rspo2_chr15_43070944 |
AGGCAATGATGGGTACAGATCTATCATATGTGGAATTGATGCTAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAG CAGCCTCATCCAGAAAGTTGACCCTGAAGCACTAGATATGAAAGGACTGTCTTGAGGCT |
| mm4_intergenic_Epm2aip1|Trank1_chr9_111303504 |
TGGAGGCCTGTGGTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAATGTGGGTTACATGTGTGTGTGTATGTGT |
| mm4_intergenic_1700123L14Rik|Gm22971_chr6_96187249 |
TCAGGTTATTGTGGGTATTGCCCATAGTTTTCATTCTGGATGGGGTATCAAGTGTCAATAACTATGTATAGGTCAAGGTA TGCCAGGAGCTTGGAG |
| mm3_intergenic_C230029F24Rik|PCGEM1_chr1_49920028 |
ACCCGCACTCCAAAATCCTTGGCTCTTCTTTCATGTTTATGTGTTTGGATGTGGTGAATCCACTGAAGTTACTGCTTCTT CTGATATATCCTTGACAACATCTCTGCTCT |
| mm4_intergenic_Siglec1|Hspa12b_chr2_131106106 |
GGTCTCTCTTCAGCACTCGGTGCTCCCCTTTTCCCTATTCTCTAGCCCCAACCAGGAAGCTAACCATGTGCTTTCTTCCT TTAGCTACACAGATGTCATTGATGTTGTGCAAGCCCTGCAGACTCACTCAGAC |
| mm4_intergenic_Gm23733|6530403H02Rik_chr3_120460410 |
ACTTGACAACAACAGCCCTGATTTCATGATCATTTTCTTCCACATTCAGGAACAAAAACATGCCTTCAAGTGCTACTGAT ATGACAGCAACTCTAAGTCCAATATATGGTGAATGTATTAATTGCCAATGCTTTGCTCCA |
| mm4_intergenic_Gm8793|Nkain2_chr10_31736924 |
CCCCTCTCTCTGTCACACACACATATACACACAGCCCCCACATATTCCACATTCATAGACATAAACATGGGTTGACAGCA CTCAGGAAA |
| mm4_intron_Gm5483_chr16_36185828 |
GGGAGGCAGAGAAACAGACAGTACTTATAGGAAGCATTTTCTGTATCACAGCAATAGTCCCCCCTCCAGAGAAAAAACCA TGGGGCACATATTATGGAAATCCCTTGTTAAGTCAGGA |
| mm4_intergenic_Commd1/RP23-242C19.7|Cct4_chr11_22990125 |
TTCACACTTTGCTCAGCAGATAACTATTAATCAGTTATTAGAATGTTTATGTTCCCTAAGAGTCAGTGGTTATGTTTATG GAAGAGGTCTTAACTAGAAGGCAGACTGGATTTGATAGGCAGTCACCGCC |
| mm4_intergenic_Gm26535|Gm24710_chr10_37586785 |
CCCTTCACAGTTTGAACATGTCAATGGAAGTTTTATTCACTAGTCAATGAACCCTTGTTATGTTTCTGAAAGTGGTACCA GGGGTAACAGAATATATGAGT |
| mm3_intron_Dzip1l_chr9_99664469 |
GACTCCGAGATGCTGCTTCATGCCCGCTGCATAGTCCAAGCCTGTCAGCCTGTGAGAAGCCACCAGGGTTAGTTTTCTGG ATGGAGCCTTGCTGCCTTAGTGGGCGGGCTGGCAAGATGATGGAGCTGG |
| mm4_intergenic_Xirp2|mmu-mir-7224_chr2_67593627 |
TCAAGGTTTACCCCACAGCCCAGAGCTGGACGTTGCTCGACCGCCATGATGTCCATTCACCCTCTCCCCCCACCCCCCCC ACCCCGTCCATAAACACAAGCATGAGAGCATTTCCACAGCACTTTCATCTCTCCTGCA |
| mm4_intergenic_Fut8|Gm24070_chr12_77600201 |
CAGCAGTGCCATTTCCGTGGGTGGCTGCGGCCTTGTTTTCTTTCTGGATGAGGACGAGCAGATCTTCATAGGACTCTGCT TTTATCATCTGTCTAACTGACATGTGACACCACAGAAAGGTCTCACCGTACTTGCC |
| mm4_intergenic_Gm22797|Robo1_chr16_72224921 |
GGATTCCTCTCCCTCCTGGTATAATCTCTTTCCATGGTACTGTTTCTGTTTGAGGTTGTTTATCTCTGAATGCTGGACAC AGGGCTTCTCTC |
| mm4_intron_BC016423_chr13_3585741 |
ACTGCAAAAGAGGCAATTTCCTAATAGTTTTCTTTCTGGATGTAGAGAAAAGCCAAATGAAGTCTTTATCCTCAATCACA GGAGATGTGAAATGAATCAACAACCTGCCTACAAAAGGGCA |
| mm4_intron_Pde1a_chr2_79925338 |
TGACTTGAGGACCATGGAGACCTAAGCCAGCAAAATAACCATGAAGTCATAATTTCCATGGGAAGGACATTATCTAAGAA TGAATAAATATAGCATATTACCACTCAAAGTTTGAACATCCAGGCA |
| mm4_intron_Xrcc4_chr13_90088209 | TCTTTACTAGAGCCTGGACCAGAACCTCATACAGAAACATCAACCTGAAGTGTCAAACAGTAGGACCTAGCA |
| mm4_exon_Gm26577/Myb_chr10_21146143 |
AGGACCAAACCGTATTTGCTATAGAAAATGGCAATGATTTATGCTATACCAATTCTCAATTCCTCTTCCAGAAACATCAA CGTGCCTTAGCAATTCTACTTACAGAATCTATAAACTGGAGTGTTTCTGCAAATTCT |
| mm4_intron_Prkar1b_chr5_139023125 |
GCATGCGCACACATTCCCCCCACACTCAAACCCACCTCCAGACACATACACATGTCCGGTAAACACAAAGCCAGGGTGCG GTGTTCTGGCCTGAGGAGCCTGAGCCCTAGCACTTAC |
| mm4_exon_Itpr2_chr6_146159013 |
TGGTTCAGCACGGTGACAATGCACATGAGCAGGGTATCACATGTCCTTTCTATGCCATCCTCACCTTCCTCGCCGGCTGC AGAAACACAACCATGAAAGAGTTTTGAAAACGCACCATTGTGAACATCGG |
| mm4_intergenic_Gm22527|Rnf144a_chr12_25934936 |
TTTCAAACTGGTGGCCCACAGCCCCCTCCAGACCCATAAACATGTTTATGTGCCTCACTCCATCATTCTTCATCCCAGGA AACATTTATATCCGAAGAATTTCACATAAAAAGTCAGACCTGCCAACTCCAG |
| mm4_intron_Cntn4_chr6_105866519 |
ACAGGTGGATGGAATGAAGTGTAGAAATCTCAGCCATGGTACTGATTCTCGATGAGGTGTGTCCCTTCACATAAACCCAG CTACCCAACAAGT |
| mm4_intergenic_Gm14899|Tex16_chrX_111949726 |
ACATAGGTGAGTGCACATGCATATACATATACCACATGCACAAACATACCCATACATGCATTTATTAAAAAATAAATGAA AAGTGAATATATAAATCATATAAATCAGTGTTGTATTGGTTGTGGTGT |
| mm3_intergenic_Far1|Far1/1700006P19Rik_chr7_113547719 |
ACTCTGCATATCCTCTGCCATATTGTTCATGGTTATGTCTGTTGATGAGGTCAATGTAGAGTTTTCCCTTTCGATTAGCT AATGATTAGAGAAAGGCCTCTGAATAATTTATCCATGTGTTAGAGGCTTGGT |