← return to the list of all guides
Contents:In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.
In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.
If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.
| Name | Primer Sequence | Tm | CFD Score |
|---|---|---|---|
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313825_F | TCGTCGGCAGCGTCAGGGAGCCTGGGATTAGGAG | 60.1 | 1.00 |
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313825_R | GTCTCGTGGGCTCGGTACCAACCAGAGTGCCAAGC | 60.2 | 1.00 |
| mm2_intergenic_4930552P12Rik|Tcf7l2_chr19_55733090_F | Primer3: not found at this Tm | N.d. | 0.71 |
| mm2_intergenic_4930552P12Rik|Tcf7l2_chr19_55733090_R | Primer3: not found at this Tm | N.d. | 0.71 |
| mm4_intron_Erp27_chr6_136915945_F | Primer3: not found at this Tm | N.d. | 0.61 |
| mm4_intron_Erp27_chr6_136915945_R | Primer3: not found at this Tm | N.d. | 0.61 |
| mm2_intergenic_Rxrb|Col11a2_chr17_34039129_F | TCGTCGGCAGCGTCGATTACGAGTGGGCGTGGAA | 60.1 | 0.57 |
| mm2_intergenic_Rxrb|Col11a2_chr17_34039129_R | GTCTCGTGGGCTCGGTAGTCCTTTCACACCACGGC | 59.9 | 0.57 |
| mm4_intron_Zfp64_chr2_168911034_F | Primer3: not found at this Tm | N.d. | 0.54 |
| mm4_intron_Zfp64_chr2_168911034_R | Primer3: not found at this Tm | N.d. | 0.54 |
| mm3_intron_Btbd16_chr7_130797858_F | TCGTCGGCAGCGTCTGCTTCTGGCTTTGACCCTT | 59.8 | 0.50 |
| mm3_intron_Btbd16_chr7_130797858_R | GTCTCGTGGGCTCGGAGGAGGACACATGCACAGTG | 59.9 | 0.50 |
| mm4_intergenic_Gm24035|Cdh13_chr8_118459731_F | Primer3: not found at this Tm | N.d. | 0.44 |
| mm4_intergenic_Gm24035|Cdh13_chr8_118459731_R | Primer3: not found at this Tm | N.d. | 0.44 |
| mm4_intron_Kctd3_chr1_188988363_F | TCGTCGGCAGCGTCATGGGGCTGGGTTTTCCAAA | 60.1 | 0.39 |
| mm4_intron_Kctd3_chr1_188988363_R | GTCTCGTGGGCTCGGACCTGAGAGGAGCCAGAAGT | 59.8 | 0.39 |
| mm4_intergenic_Kcnf1|Pdia6_chr12_17179267_F | Primer3: not found at this Tm | N.d. | 0.39 |
| mm4_intergenic_Kcnf1|Pdia6_chr12_17179267_R | Primer3: not found at this Tm | N.d. | 0.39 |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911234_F | TCGTCGGCAGCGTCCGGGGTCAGTGGTTCACTC | 60.0 | 0.36 |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911234_R | GTCTCGTGGGCTCGGGACAGCCCCGAGACACCAG | 62.3 | 0.36 |
| mm4_intron_Spred2_chr11_20006528_F | Primer3: not found at this Tm | N.d. | 0.32 |
| mm4_intron_Spred2_chr11_20006528_R | Primer3: not found at this Tm | N.d. | 0.32 |
| mm4_exon_Lhx3_chr2_26200605_F | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_exon_Lhx3_chr2_26200605_R | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_intron_Dph5_chr3_115899115_F | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_intron_Dph5_chr3_115899115_R | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_intergenic_Mvb12b|Gm13403_chr2_33898619_F | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intergenic_Mvb12b|Gm13403_chr2_33898619_R | Primer3: not found at this Tm | N.d. | 0.28 |
| mm3_intergenic_1700036O09Rik|Gm14689_chrX_67473959_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intergenic_1700036O09Rik|Gm14689_chrX_67473959_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Gm16080|Ptpru_chr4_131721933_F | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intergenic_Gm16080|Ptpru_chr4_131721933_R | Primer3: not found at this Tm | N.d. | 0.24 |
| mm4_intergenic_Cers3|Adamts17_chr7_66835373_F | TCGTCGGCAGCGTCGACCATGGAATCAAGCCGGA | 60.1 | 0.23 |
| mm4_intergenic_Cers3|Adamts17_chr7_66835373_R | GTCTCGTGGGCTCGGTGGGGCTATCTGAGGGTGAA | 59.9 | 0.23 |
| mm4_intergenic_mmu-mir-7239|Cyfip2_chr11_46181851_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_mmu-mir-7239|Cyfip2_chr11_46181851_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intron_Col9a2_chr4_121040107_F | TCGTCGGCAGCGTCGCTATTCAGTCGACAGCGGA | 59.8 | 0.22 |
| mm4_intron_Col9a2_chr4_121040107_R | GTCTCGTGGGCTCGGCATATTGGGGCGACAGGGAA | 59.8 | 0.22 |
| mm4_exon_Susd4_chr1_182764167_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_exon_Susd4_chr1_182764167_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Gm22507|Trhde_chr10_114071766_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Gm22507|Trhde_chr10_114071766_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intron_Antxr1_chr6_87158190_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intron_Antxr1_chr6_87158190_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Gm17055|Bhlhe40/0610040F04Rik_chr6_108659708_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm17055|Bhlhe40/0610040F04Rik_chr6_108659708_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Sned1_chr1_93241390_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Sned1_chr1_93241390_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Uty_chrY_1203306_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Uty_chrY_1203306_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Gm13849_chr6_31914158_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Gm13849_chr6_31914158_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Dpp10_chr1_123870418_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Dpp10_chr1_123870418_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Stac|Arpp21_chr9_111849361_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Stac|Arpp21_chr9_111849361_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_St8sia2|AC114591.1_chr7_74084092_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_St8sia2|AC114591.1_chr7_74084092_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm26475|Gm24522_chrX_128619008_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm26475|Gm24522_chrX_128619008_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm25977|Gm11875_chr4_21428592_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm25977|Gm11875_chr4_21428592_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm24442|Col1a2_chr6_4476193_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm24442|Col1a2_chr6_4476193_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm23752|Gm24815_chr12_7276176_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm23752|Gm24815_chr12_7276176_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Eif3s6-ps2|Gm25418_chr18_90498591_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Eif3s6-ps2|Gm25418_chr18_90498591_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Edem1|Gm20387_chr6_109061566_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Edem1|Gm20387_chr6_109061566_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Cntn5|Gm25365_chr9_11019535_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Cntn5|Gm25365_chr9_11019535_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Tldc1_chr8_119765814_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Tldc1_chr8_119765814_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm22777|Spock1_chr13_57118638_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Gm22777|Spock1_chr13_57118638_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Rims2_chr15_39522657_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Rims2_chr15_39522657_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Aff1_chr5_103778575_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Aff1_chr5_103778575_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Fam163b_chr2_27118669_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Fam163b_chr2_27118669_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Lrrc4c_chr2_97429036_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intron_Lrrc4c_chr2_97429036_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm3_intergenic_Rab17|Lrrfip1_chr1_90972880_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm3_intergenic_Rab17|Lrrfip1_chr1_90972880_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intergenic_Gm5868|Cnga1_chr5_72602552_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Gm5868|Cnga1_chr5_72602552_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Gm22312|Magi1_chr6_93562550_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Gm22312|Magi1_chr6_93562550_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_1700012P22Rik|Gm9944_chr4_144444010_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_1700012P22Rik|Gm9944_chr4_144444010_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Stk32c|U6_chr7_139191650_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Stk32c|U6_chr7_139191650_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm4_intergenic_Rhobtb2|Pebp4_chr14_69837091_F | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_intergenic_Rhobtb2|Pebp4_chr14_69837091_R | Primer3: not found at this Tm | N.d. | 0.14 |
| mm3_intergenic_Gm14246|Gm22936_chr2_162742448_F | TCGTCGGCAGCGTCGTGACCACTTACAGGCAGCT | 59.9 | 0.14 |
| mm3_intergenic_Gm14246|Gm22936_chr2_162742448_R | GTCTCGTGGGCTCGGTCGTGAGAACTGTCTGGAGC | 59.4 | 0.14 |
| mm4_intergenic_CT030233.1|Gm20675_chr14_67157566_F | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_intergenic_CT030233.1|Gm20675_chr14_67157566_R | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_exon_Sec62/4933429H19Rik_chr3_30793550_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_exon_Sec62/4933429H19Rik_chr3_30793550_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm11981|Gm11977_chr11_6761502_F | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intergenic_Gm11981|Gm11977_chr11_6761502_R | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intron_Gm13387_chr2_25130289_F | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intron_Gm13387_chr2_25130289_R | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_intergenic_Xpnpep1|Add3_chr19_53087719_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Xpnpep1|Add3_chr19_53087719_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Cenpw|Gm22623_chr10_30436091_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Cenpw|Gm22623_chr10_30436091_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intron_Ablim2_chr5_35794655_F | TCGTCGGCAGCGTCGCATAGGCCTTAGGGTTGCA | 60.1 | 0.11 |
| mm4_intron_Ablim2_chr5_35794655_R | GTCTCGTGGGCTCGGGTAACCTGAGGCCAAGAGCA | 59.6 | 0.11 |
| mm4_intron_Unc13c_chr9_73952449_F | TCGTCGGCAGCGTCGGCATGACTGAGTTGGGTCA | 59.9 | 0.10 |
| mm4_intron_Unc13c_chr9_73952449_R | GTCTCGTGGGCTCGGCACCCAGAGTAGGAAGCAGC | 60.1 | 0.10 |
| mm4_intergenic_Frem2|Gm24851_chr3_53744727_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Frem2|Gm24851_chr3_53744727_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_exon_Tnfaip2_chr12_111445096_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_exon_Tnfaip2_chr12_111445096_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_exon_Shisa9_chr16_11984727_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_exon_Shisa9_chr16_11984727_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Tle3|Rplp1_chr9_61630302_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Tle3|Rplp1_chr9_61630302_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intron_Adcy7_chr8_88313430_F | TCGTCGGCAGCGTCGACTGCTGACTCCCATCCAG | 59.8 | 0.09 |
| mm4_intron_Adcy7_chr8_88313430_R | GTCTCGTGGGCTCGGGGAAGGAAGAGGGAAGGTGC | 60.0 | 0.09 |
| mm4_intergenic_Gm5973|Gm9915_chr1_40920481_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Gm5973|Gm9915_chr1_40920481_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Emc2|Tmem74_chr15_43602626_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Emc2|Tmem74_chr15_43602626_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intron_Mmp24_chr2_155805696_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intron_Mmp24_chr2_155805696_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_Hecw1|Mrpl32_chr13_14563161_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Hecw1|Mrpl32_chr13_14563161_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm7910|Khdrbs2_chr1_31790527_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm7910|Khdrbs2_chr1_31790527_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm14751|Rps24-ps3_chrX_79123850_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm14751|Rps24-ps3_chrX_79123850_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Map3k10_chr7_27661707_F | TCGTCGGCAGCGTCGTACTGCAGGGTGGTAAGCA | 59.6 | 0.08 |
| mm4_intron_Map3k10_chr7_27661707_R | GTCTCGTGGGCTCGGTGAAGCACTGACCGCTACTG | 60.0 | 0.08 |
| mm4_intergenic_Fbxo21|Tesc_chr5_118010562_F | TCGTCGGCAGCGTCACACCGCTAGGCTACTCAGA | 60.0 | 0.08 |
| mm4_intergenic_Fbxo21|Tesc_chr5_118010562_R | GTCTCGTGGGCTCGGGGCTTGACTGAGGAAGACCC | 60.0 | 0.08 |
| mm4_intron_Klf8_chrX_153293911_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Klf8_chrX_153293911_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm25335|Magi2_chr5_19566729_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm25335|Magi2_chr5_19566729_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Fgf13_chrX_59433870_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intron_Fgf13_chrX_59433870_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm14561|Gm6071_chrX_22235595_F | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Gm14561|Gm6071_chrX_22235595_R | Primer3: not found at this Tm | N.d. | 0.08 |
| mm4_intergenic_Kdm6b|Dnah2_chr11_69420123_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Kdm6b|Dnah2_chr11_69420123_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Mir694|Ccbe1_chr18_66230038_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Mir694|Ccbe1_chr18_66230038_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Sik1|Hsf2bp_chr17_31919987_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Sik1|Hsf2bp_chr17_31919987_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Tmc7_chr7_118582405_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Tmc7_chr7_118582405_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_4930578M01Rik|Gm8973_chr15_98998655_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_4930578M01Rik|Gm8973_chr15_98998655_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Itpr2_chr6_146264448_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Itpr2_chr6_146264448_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Gm13670|Agps_chr2_75829040_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Gm13670|Agps_chr2_75829040_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Ezr_chr17_6758120_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Ezr_chr17_6758120_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Calml4_chr9_62871012_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Calml4_chr9_62871012_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Zfp652|Phospho1_chr11_95780681_F | TCGTCGGCAGCGTCACACCCAGCAGAAATCTTGGA | 59.5 | 0.06 |
| mm4_intergenic_Zfp652|Phospho1_chr11_95780681_R | GTCTCGTGGGCTCGGTGCATAGAACGTCGGACACA | 59.4 | 0.06 |
| mm4_intron_Ltn1_chr16_87414984_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Ltn1_chr16_87414984_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_exon_Zcchc2_chr1_105990541_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_exon_Zcchc2_chr1_105990541_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm3_intergenic_Gm24371|BC024582_chr4_32540354_F | TCGTCGGCAGCGTCACAGACTGTGTCAGGAACGT | 58.8 | 0.06 |
| mm3_intergenic_Gm24371|BC024582_chr4_32540354_R | GTCTCGTGGGCTCGGGGTCCTTGCCCATGTATGCT | 60.1 | 0.06 |
| mm4_intergenic_Ccnt2|Map3k19_chr1_127809806_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Ccnt2|Map3k19_chr1_127809806_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Gm16029/Egflam|Gm16029_chr15_7405104_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Gm16029/Egflam|Gm16029_chr15_7405104_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Ehf_chr2_103276705_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Ehf_chr2_103276705_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Dock1_chr7_134832182_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Dock1_chr7_134832182_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm3_intergenic_Gm9843|Usp25_chr16_76470165_F | TCGTCGGCAGCGTCCTGTTTTCTGGCTGTGTTGGG | 59.9 | 0.05 |
| mm3_intergenic_Gm9843|Usp25_chr16_76470165_R | GTCTCGTGGGCTCGGGTGTCAAGTGCAAGCATGACA | 59.6 | 0.05 |
| mm4_intergenic_Gm24280|Rbm26/Gm17066_chr14_105074324_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm24280|Rbm26/Gm17066_chr14_105074324_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Nap1l2|Gm9050_chrX_103193603_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Nap1l2|Gm9050_chrX_103193603_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Phf17_chr3_41557562_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Phf17_chr3_41557562_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Gm12122|Slit3_chr11_35478027_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm12122|Slit3_chr11_35478027_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23440|Rapgef2_chr3_79041230_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23440|Rapgef2_chr3_79041230_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23960|Gm26373_chr6_21087216_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23960|Gm26373_chr6_21087216_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23083|Gm24773_chr16_80464668_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm23083|Gm24773_chr16_80464668_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm2_intergenic_n-R5s42|Fam19a5_chr15_87215595_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm2_intergenic_n-R5s42|Fam19a5_chr15_87215595_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Clnk_chr5_38771605_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intron_Clnk_chr5_38771605_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm4487|Gm24073_chr14_114451568_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm4487|Gm24073_chr14_114451568_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Dysf|Cyp26b1_chr6_84474591_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Dysf|Cyp26b1_chr6_84474591_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm3_exon_Gm26545_chr12_80885687_F | TCGTCGGCAGCGTCTGTAGATGAAGCCTGCCAGC | 60.1 | 0.04 |
| mm3_exon_Gm26545_chr12_80885687_R | GTCTCGTGGGCTCGGCCCCGAAATGAGGCAGCATA | 60.1 | 0.04 |
| mm4_intron_Scg5_chr2_113799105_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Scg5_chr2_113799105_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Lrpap1|Adra2c_chr5_35248229_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Lrpap1|Adra2c_chr5_35248229_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Ear6|Mettl17_chr14_51866882_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Ear6|Mettl17_chr14_51866882_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Rsbn1l|Ptpn12_chr5_20975538_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Rsbn1l|Ptpn12_chr5_20975538_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm3_exon_Efnb2_chr8_8620317_F | TCGTCGGCAGCGTCTCTCCTAAGATGCTGCTGCG | 59.8 | 0.03 |
| mm3_exon_Efnb2_chr8_8620317_R | GTCTCGTGGGCTCGGGAGATCCCCACTTGGACTGC | 60.1 | 0.03 |
| mm4_intergenic_1700008P02Rik|Gm22074_chr3_6971478_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_1700008P02Rik|Gm22074_chr3_6971478_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm23041|Nav3_chr10_109534630_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intergenic_Gm23041|Nav3_chr10_109534630_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm3_intergenic_Hmg20a|Gm26868_chr9_56503737_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm3_intergenic_Hmg20a|Gm26868_chr9_56503737_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_St6gal1|Gm23430_chr16_23394800_F | TCGTCGGCAGCGTCACAAGAACCAAAGAGAGCCCC | 60.2 | 0.02 |
| mm4_intergenic_St6gal1|Gm23430_chr16_23394800_R | GTCTCGTGGGCTCGGTGTGTTCGGTTGTCCATGTGA | 60.1 | 0.02 |
| mm4_intergenic_Gm14224|Epb4.1l1_chr2_156460996_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm14224|Epb4.1l1_chr2_156460996_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22593|Mettl4_chr17_94706024_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22593|Mettl4_chr17_94706024_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Adra2a|Gpam_chr19_54704433_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Adra2a|Gpam_chr19_54704433_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ccdc130|Gm23626_chr8_84362613_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ccdc130|Gm23626_chr8_84362613_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Zfp442_chr2_150427092_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Zfp442_chr2_150427092_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Vmn2r60_chr7_42166972_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Vmn2r60_chr7_42166972_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Tanc2_chr11_105815770_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Tanc2_chr11_105815770_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Spopl_chr2_23533667_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Spopl_chr2_23533667_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Sntg1_chr1_8709427_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Sntg1_chr1_8709427_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Abca13_chr11_9455573_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Abca13_chr11_9455573_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_5830411N06Rik_chr7_140291387_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_5830411N06Rik_chr7_140291387_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_n-R5s209|Gm7846_chr1_26992819_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_n-R5s209|Gm7846_chr1_26992819_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn2r60|Vmn2r61_chr7_42201791_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn2r60|Vmn2r61_chr7_42201791_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r29|Gm20674_chr6_58359114_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r29|Gm20674_chr6_58359114_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r238|Crem_chr18_3205692_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r238|Crem_chr18_3205692_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ttc32|Gm7099_chr12_9320551_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ttc32|Gm7099_chr12_9320551_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Tbx15|Gm12449_chr3_99391902_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Tbx15|Gm12449_chr3_99391902_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_St3gal1|Zfat_chr15_67870235_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_St3gal1|Zfat_chr15_67870235_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Spag11a|Defb14_chr8_19181248_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Spag11a|Defb14_chr8_19181248_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc22a29|Slc22a30_chr19_8327358_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc22a29|Slc22a30_chr19_8327358_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc22a27|Slc22a28_chr19_8042450_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slc22a27|Slc22a28_chr19_8042450_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Sema3d|Gm23243_chr5_12799666_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Sema3d|Gm23243_chr5_12799666_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Lmo7|Gm22347_chr14_102285404_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Lmo7|Gm22347_chr14_102285404_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Itgbl1|Gm9308_chr14_123674037_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Itgbl1|Gm9308_chr14_123674037_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Has2os|Gm26178_chr15_57194014_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Has2os|Gm26178_chr15_57194014_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gtpbp4|Larp4b_chr13_9048183_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gtpbp4|Larp4b_chr13_9048183_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gpc5|Gpc6_chr14_116888946_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gpc5|Gpc6_chr14_116888946_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm884|Gm11643_chr11_103596518_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm884|Gm11643_chr11_103596518_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7191|Gm23494_chr8_97833631_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7191|Gm23494_chr8_97833631_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm6367|Gm7942_chr5_95094844_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm6367|Gm7942_chr5_95094844_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm6205|Gm3183_chr5_94764601_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm6205|Gm3183_chr5_94764601_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm5257|mmu-mir-6343_chr1_76234207_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm5257|mmu-mir-6343_chr1_76234207_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm3259|D5Ertd577e_chr5_95412315_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm3259|D5Ertd577e_chr5_95412315_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26341|Amd2_chr10_35309631_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26341|Amd2_chr10_35309631_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25756|Gm22553_chr5_79203628_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25756|Gm22553_chr5_79203628_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23950|Gm11218_chr4_64737949_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23950|Gm11218_chr4_64737949_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23848|Trps1_chr15_50204384_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23848|Trps1_chr15_50204384_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23476|Gm26159_chr16_8270883_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23476|Gm26159_chr16_8270883_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23189|Gm15671_chr1_68015976_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23189|Gm15671_chr1_68015976_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22438|Gm22159_chr1_108428923_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22438|Gm22159_chr1_108428923_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm21447|Spin2f_chrX_31229611_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm21447|Spin2f_chrX_31229611_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm17615|Fgf14_chr14_124009446_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm17615|Fgf14_chr14_124009446_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm16685|Gm24614_chr3_7832932_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm16685|Gm24614_chr3_7832932_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13506|Gm13454_chr2_39425994_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13506|Gm13454_chr2_39425994_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13504|Vmn2r-ps2_chr2_39265670_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm13504|Vmn2r-ps2_chr2_39265670_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm11746|Slc24a3_chr2_144979411_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm11746|Slc24a3_chr2_144979411_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_GM6367|AC123873.1_chr5_JH584299_random_76907_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_GM6367|AC123873.1_chr5_JH584299_random_76907_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Eya1|Msc_chr1_14388601_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Eya1|Msc_chr1_14388601_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Csgalnact1|Ints10_chr8_68759754_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Csgalnact1|Ints10_chr8_68759754_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdh9|Gm22032_chr15_16863885_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdh9|Gm22032_chr15_16863885_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_C87414|AC140365.1_chr5_JH584299_random_703858_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_C87414|AC140365.1_chr5_JH584299_random_703858_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_B430218F22Rik/Mrps30|Fgf10_chr13_118463510_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_B430218F22Rik/Mrps30|Fgf10_chr13_118463510_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC126035.1|Gm16367_chr5_JH584299_random_383381_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC126035.1|Gm16367_chr5_JH584299_random_383381_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_A830012C17Rik|Gm11780_chr4_4479069_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_A830012C17Rik|Gm11780_chr4_4479069_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26784|1700018B08Rik_chr8_121523584_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26784|1700018B08Rik_chr8_121523584_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Pinc|Gm25329_chr1_73609295_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Pinc|Gm25329_chr1_73609295_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Skint11|Trabd2b_chr4_114255181_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Skint11|Trabd2b_chr4_114255181_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12813|Skint5_chr4_113404871_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12813|Skint5_chr4_113404871_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cplx1|Gak_chr5_108552068_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cplx1|Gak_chr5_108552068_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm4419|Gm5633_chr12_21512728_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm4419|Gm5633_chr12_21512728_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Add2_chr6_86110503_F | TCGTCGGCAGCGTCCTAGCCCCTGAGAACAAGCC | 60.1 | 0.02 |
| mm4_intron_Add2_chr6_86110503_R | GTCTCGTGGGCTCGGCAAGCACAGATGGAGGCAGA | 60.0 | 0.02 |
| mm4_intergenic_4931408C20Rik|n-R5s209_chr1_26709176_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_4931408C20Rik|n-R5s209_chr1_26709176_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdh7|Cdh19_chr1_110717926_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Cdh7|Cdh19_chr1_110717926_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26327|Gm6851_chr7_39765113_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26327|Gm6851_chr7_39765113_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Spanxn4|Gm7763_chr12_62689618_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Spanxn4|Gm7763_chr12_62689618_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Rarb_chr14_16474134_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Rarb_chr14_16474134_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Pbrm1_chr14_31096764_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Pbrm1_chr14_31096764_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Naip3_chr13_100366695_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Naip3_chr13_100366695_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rbfox1|Gm23476_chr16_7816943_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rbfox1|Gm23476_chr16_7816943_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Kcnk12|Rpl36-ps4_chr17_87806199_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Kcnk12|Rpl36-ps4_chr17_87806199_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25491|Eya1_chr1_14024694_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25491|Eya1_chr1_14024694_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25051|Gm1818_chr12_47730521_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm25051|Gm1818_chr12_47730521_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22782|Rpl10l_chr12_66067245_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22782|Rpl10l_chr12_66067245_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22062|Gm15224_chrX_165839454_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm22062|Gm15224_chrX_165839454_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12610|Dmrta1_chr4_89495079_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm12610|Dmrta1_chr4_89495079_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Fam110b|Gm11797_chr4_5896118_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Fam110b|Gm11797_chr4_5896118_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Dcx|Gm15048_chrX_144086532_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Dcx|Gm15048_chrX_144086532_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Bambi|Gm23643_chr18_3751556_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Bambi|Gm23643_chr18_3751556_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC112986.1|Tsn_chr1_118186786_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC112986.1|Tsn_chr1_118186786_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC112986.1|Tsn_chr1_117975191_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_AC112986.1|Tsn_chr1_117975191_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Il27|Nupr1_chr7_126614642_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Il27|Nupr1_chr7_126614642_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Dtnb_chr12_3653373_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Dtnb_chr12_3653373_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ythdf3|Gm26485_chr3_16437336_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ythdf3|Gm26485_chr3_16437336_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r69|Vmn1r70_chr7_10622067_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Vmn1r69|Vmn1r70_chr7_10622067_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slitrk2|Gm23000_chrX_66723352_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Slitrk2|Gm23000_chrX_66723352_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rfc3|Gm24242_chr5_151676661_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rfc3|Gm24242_chr5_151676661_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rarb|Thrb_chr14_17281252_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Rarb|Thrb_chr14_17281252_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7719|Gm24377_chr12_59650965_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm7719|Gm24377_chr12_59650965_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26820|Tacr3_chr3_134795922_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26820|Tacr3_chr3_134795922_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26820|Tacr3_chr3_134787584_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm26820|Tacr3_chr3_134787584_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24790|Klf6_chr13_5383344_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm24790|Klf6_chr13_5383344_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23228|Fbxo4_chr15_3889063_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23228|Fbxo4_chr15_3889063_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23097|Dync2h1_chr9_6770071_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Gm23097|Dync2h1_chr9_6770071_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85643750_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85643750_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_4930415L06Rik|Gm6027_chrX_89942443_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_4930415L06Rik|Gm6027_chrX_89942443_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Acvr2a_chr2_48856548_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Acvr2a_chr2_48856548_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Trav15n-1|Trav9n-2_chr14_53182979_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Trav15n-1|Trav9n-2_chr14_53182979_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Olfr892-ps1|Olfr893_chr9_38204649_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Olfr892-ps1|Olfr893_chr9_38204649_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26190|B3gat1_chr9_26510004_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26190|B3gat1_chr9_26510004_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm18367|Gm20713/Gpc5_chr14_115707217_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm18367|Gm20713/Gpc5_chr14_115707217_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Arl15|Ndufs4_chr13_114247000_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Arl15|Ndufs4_chr13_114247000_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm7405|Dach2_chrX_113277264_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm7405|Dach2_chrX_113277264_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Lpl|Slc18a1_chr8_68916573_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Lpl|Slc18a1_chr8_68916573_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12458|Gm25485_chr4_50105228_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12458|Gm25485_chr4_50105228_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ppapdc1a_chr7_129277182_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ppapdc1a_chr7_129277182_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm23117|Gm5083_chr13_43936733_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm23117|Gm5083_chr13_43936733_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Lrrc48_chr11_60382342_F | TCGTCGGCAGCGTCCCATTCGCACCTTCTGAGGA | 59.7 | 0.01 |
| mm4_intron_Lrrc48_chr11_60382342_R | GTCTCGTGGGCTCGGCAGCTTCTTGTGGGCTGAGA | 59.9 | 0.01 |
| mm4_intron_March1_chr8_66241592_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_March1_chr8_66241592_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Atg10_chr13_91148020_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Atg10_chr13_91148020_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm25415|Gm10110_chr14_89721186_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm25415|Gm10110_chr14_89721186_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5839|Gm25440_chr18_49373802_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5839|Gm25440_chr18_49373802_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Vmn2r-ps69_chr7_85322035_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Vmn2r-ps69_chr7_85322035_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ass1_chr2_31509697_F | TCGTCGGCAGCGTCGCGTGTTCATGCATGTGTGT | 60.0 | 0.01 |
| mm4_intron_Ass1_chr2_31509697_R | GTCTCGTGGGCTCGGGGCCTGCAGTTGAAAACCTG | 59.9 | 0.01 |
| mm4_intergenic_Zcchc6|Gas1_chr13_60014352_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Zcchc6|Gas1_chr13_60014352_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Prodh2_chr7_30500996_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Prodh2_chr7_30500996_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ndufaf5_chr2_140184141_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ndufaf5_chr2_140184141_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm25551|Jakmip1_chr5_37098922_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm25551|Jakmip1_chr5_37098922_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Casp12|Pdgfd_chr9_6061091_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Casp12|Pdgfd_chr9_6061091_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm3_intergenic_Capn8|4922505E12Rik_chr1_182728006_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm3_intergenic_Capn8|4922505E12Rik_chr1_182728006_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Cntnap5a_chr1_116050723_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Cntnap5a_chr1_116050723_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Cd36_chr5_17792011_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Cd36_chr5_17792011_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60993163_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60993163_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60984957_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60984957_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60970303_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tpbpa|Ctsj_chr13_60970303_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tmem65|Ube2d4_chr15_58837032_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tmem65|Ube2d4_chr15_58837032_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tmem108|Nphp3_chr9_103799894_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Tmem108|Nphp3_chr9_103799894_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Stc2|Bod1_chr11_31587766_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Stc2|Bod1_chr11_31587766_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Spata4|Wdr17_chr8_54625000_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Spata4|Wdr17_chr8_54625000_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Rpl7a-ps10|Trim42/Gm15891_chr9_97219677_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Rpl7a-ps10|Trim42/Gm15891_chr9_97219677_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Rgs1|Rgs21_chr1_144476994_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Rgs1|Rgs21_chr1_144476994_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Pdzrn4|Gm4335_chr15_92885552_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Pdzrn4|Gm4335_chr15_92885552_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Macc1|Gm25675_chr12_119857780_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Macc1|Gm25675_chr12_119857780_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Kcnt2|Gm4845_chr1_141126871_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Kcnt2|Gm4845_chr1_141126871_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Kcnh5|Rhoj_chr12_75194612_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Kcnh5|Rhoj_chr12_75194612_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Ikzf2|Spag16_chr1_69805727_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Ikzf2|Spag16_chr1_69805727_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Hnf4g|Gm23237_chr3_3540156_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Hnf4g|Gm23237_chr3_3540156_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gpr149|Gm22433_chr3_62637145_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gpr149|Gm22433_chr3_62637145_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5849|4930529C04Rik_chr3_90893744_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5849|4930529C04Rik_chr3_90893744_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5471|Kcnv1_chr15_45037369_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm5471|Kcnv1_chr15_45037369_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26913|Gm4076_chr13_84989156_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26913|Gm4076_chr13_84989156_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26181|Triml1_chr8_43097649_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm26181|Triml1_chr8_43097649_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm24246|Pik3c3_chr18_28343151_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm24246|Pik3c3_chr18_28343151_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22762|4930405D11Rik_chr11_90794258_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22762|4930405D11Rik_chr11_90794258_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22444|mmu-mir-6238_chr7_53051481_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm22444|mmu-mir-6238_chr7_53051481_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm17131|Tmem132d_chr5_127939438_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm17131|Tmem132d_chr5_127939438_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm13566|Gm13567_chr2_60589715_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm13566|Gm13567_chr2_60589715_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm13365|Gm13368_chr2_15403605_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm13365|Gm13368_chr2_15403605_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12551|Plin2_chr4_86642311_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12551|Plin2_chr4_86642311_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12377|Gm12376_chr3_36805258_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12377|Gm12376_chr3_36805258_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm11228|Gm11229_chr4_71155499_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm11228|Gm11229_chr4_71155499_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85919044_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85919044_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85517094_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Fbxo15|Gm25453_chr18_85517094_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cd180|Mast4_chr13_102723501_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cd180|Mast4_chr13_102723501_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Car8|Gm11810_chr4_8256760_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Car8|Gm11810_chr4_8256760_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cdh8|Gm15680_chr8_99294886_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Cdh8|Gm15680_chr8_99294886_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Pebp4|Egr3_chr14_70075565_F | TCGTCGGCAGCGTCCCGGGGATCCTCTCTTCCTT | 60.3 | 0.01 |
| mm4_intergenic_Pebp4|Egr3_chr14_70075565_R | GTCTCGTGGGCTCGGGATTCCCTCCTCAGTGGCC | 59.4 | 0.01 |
| mm4_intron_Ppp1r9a_chr6_5110139_F | TCGTCGGCAGCGTCGCATCACTTAGTGGCTGTGC | 59.5 | 0.01 |
| mm4_intron_Ppp1r9a_chr6_5110139_R | GTCTCGTGGGCTCGGTGAAATTCCCAATTCTCCCGGT | 59.9 | 0.01 |
| mm4_intergenic_A330008L17Rik|Gm15210_chr8_99796818_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_A330008L17Rik|Gm15210_chr8_99796818_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_83108353_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm6594|Pkdcc_chr17_83108353_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm11515|Tac4_chr11_95226386_F | TCGTCGGCAGCGTCGCCTGGCTGTCATCTCAGAA | 59.7 | 0.01 |
| mm4_intergenic_Gm11515|Tac4_chr11_95226386_R | GTCTCGTGGGCTCGGAGGCATCTGCTGTGATCTGG | 59.8 | 0.01 |
| mm4_intergenic_Vrk1|Gm24986_chr12_106199160_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Vrk1|Gm24986_chr12_106199160_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12178|Gm12179_chr11_48331481_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm12178|Gm12179_chr11_48331481_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm8919|Gm8935_chr3_11774957_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Gm8919|Gm8935_chr3_11774957_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_5033428I22Rik|Scrg1_chr8_57377914_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_5033428I22Rik|Scrg1_chr8_57377914_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Stmn4|Gm23899_chr14_66456800_F | TCGTCGGCAGCGTCAGTGCAAGTCTTTCCCTCCA | 58.8 | 0.01 |
| mm4_intergenic_Stmn4|Gm23899_chr14_66456800_R | GTCTCGTGGGCTCGGGTGGTAATGGAATCTGGTCCCA | 59.7 | 0.01 |
| mm4_intron_Ptrf_chr11_100965309_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Ptrf_chr11_100965309_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_exon_Ttc17_chr2_94358187_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Ttc17_chr2_94358187_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Stx2_chr5_128990044_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Stx2_chr5_128990044_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gm14066_chr2_139347230_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Gm14066_chr2_139347230_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_95036392_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm9726/mmu-mir-8099-2|Gm26055_chr12_95036392_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Helt|Acsl1_chr8_46469134_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Helt|Acsl1_chr8_46469134_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Wwc1|Gm12125_chr11_35985201_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Wwc1|Gm12125_chr11_35985201_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Ccdc171|Gm27046_chr4_83589213_F | TCGTCGGCAGCGTCCAGGGAGCAGCCTTAGGAAC | 60.1 | 0.00 |
| mm4_intergenic_Ccdc171|Gm27046_chr4_83589213_R | GTCTCGTGGGCTCGGCTTACAAGGCCACCCTCCTG | 60.0 | 0.00 |
| mm4_exon_Pinlyp_chr7_24542589_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Pinlyp_chr7_24542589_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Xrra1_chr7_99872360_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Xrra1_chr7_99872360_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Wscd2_chr5_113497178_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Wscd2_chr5_113497178_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Txnrd2_chr16_18473476_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Txnrd2_chr16_18473476_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Tiam1_chr16_89972188_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Tiam1_chr16_89972188_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Shisa9_chr16_12024465_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Shisa9_chr16_12024465_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Sept8_chr11_53536569_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Sept8_chr11_53536569_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Plxna4_chr6_32227659_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Plxna4_chr6_32227659_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Nfat5_chr8_107294013_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Nfat5_chr8_107294013_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Msi2_chr11_88548267_F | TCGTCGGCAGCGTCTTTCAGCAAGGCCAGAGGAG | 59.9 | 0.00 |
| mm4_intron_Msi2_chr11_88548267_R | GTCTCGTGGGCTCGGGCAGGCTTCTACGAGTCTGC | 60.8 | 0.00 |
| mm4_intron_Mef2b/2310045N01Rik_chr8_70158608_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Mef2b/2310045N01Rik_chr8_70158608_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Etfa_chr9_55482901_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Etfa_chr9_55482901_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Elp4_chr2_105751874_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Elp4_chr2_105751874_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cux1_chr5_136305408_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Cux1_chr5_136305408_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Atp7b_chr8_21997164_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Atp7b_chr8_21997164_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Actn1_chr12_80258861_F | TCGTCGGCAGCGTCTGAGCATTCTCCCTCAAGCC | 59.7 | 0.00 |
| mm4_intron_Actn1_chr12_80258861_R | GTCTCGTGGGCTCGGAACACCCAACTCCCGTTCAG | 60.1 | 0.00 |
| mm4_intron_4930584F24Rik_chr5_26462682_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_4930584F24Rik_chr5_26462682_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Wfdc18|1100001G20Rik_chr11_83711395_F | TCGTCGGCAGCGTCTCCTTAGCATCCTTCCTGTTGA | 58.8 | 0.00 |
| mm4_intergenic_Wfdc18|1100001G20Rik_chr11_83711395_R | GTCTCGTGGGCTCGGAGGGCTCTGTCTGTGTTTATGG | 60.0 | 0.00 |
| mm4_intergenic_Tlr11|Olfr736_chr14_50367200_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Tlr11|Olfr736_chr14_50367200_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Tbx5|n-R5s176_chr5_120033702_F | TCGTCGGCAGCGTCTGACCTTAGCCTTCTGTCCTTG | 59.6 | 0.00 |
| mm4_intergenic_Tbx5|n-R5s176_chr5_120033702_R | GTCTCGTGGGCTCGGACACAGGCATCACTCAGTGG | 59.9 | 0.00 |
| mm4_intergenic_Phyh|Gm13194_chr2_4941056_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Phyh|Gm13194_chr2_4941056_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Olfr1219|Olfr1220_chr2_89093618_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Olfr1219|Olfr1220_chr2_89093618_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Mapk8|Ptpn20_chr14_33486794_F | TCGTCGGCAGCGTCTAGAGACCTGGGCCCAACTT | 60.1 | 0.00 |
| mm4_intergenic_Mapk8|Ptpn20_chr14_33486794_R | GTCTCGTGGGCTCGGATTGAGGAGCTCTGCCCTTG | 59.7 | 0.00 |
| mm4_intergenic_Lmnb2|Gadd45b_chr10_80926821_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Lmnb2|Gadd45b_chr10_80926821_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm8730|Cdh5_chr8_103737423_F | TCGTCGGCAGCGTCGACAGCATTGTAGAGATGGGGT | 59.8 | 0.00 |
| mm4_intergenic_Gm8730|Cdh5_chr8_103737423_R | GTCTCGTGGGCTCGGGAGGGCTGCTTCTCTCCAAG | 60.1 | 0.00 |
| mm4_intergenic_Gm4913|Gm16420_chrX_120050501_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm4913|Gm16420_chrX_120050501_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm25845|Celf4_chr18_25627881_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm25845|Celf4_chr18_25627881_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm25564|Dcdc2c_chr12_28389804_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm25564|Dcdc2c_chr12_28389804_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm24415|Alg10b/mmu-mir-7648_chr15_90214730_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm24415|Alg10b/mmu-mir-7648_chr15_90214730_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm23015|4932441J04Rik_chr5_57553985_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm23015|4932441J04Rik_chr5_57553985_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21856|Gm21783_chrY_44793979_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21856|Gm21783_chrY_44793979_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21783|Gm21779_chrY_45199068_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21783|Gm21779_chrY_45199068_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21774|Gm21805_chrY_42114885_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm21774|Gm21805_chrY_42114885_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm20901|Gm21865_chrY_39188431_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm20901|Gm21865_chrY_39188431_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm18822|Hey1_chr3_8626293_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm18822|Hey1_chr3_8626293_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm15747|Mlxip_chr5_123416489_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm15747|Mlxip_chr5_123416489_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm14868|Gm4784_chrX_109288828_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm14868|Gm4784_chrX_109288828_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cryaa|Sik1_chr17_31748177_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cryaa|Sik1_chr17_31748177_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cadm2|Gm24681_chr16_68130313_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cadm2|Gm24681_chr16_68130313_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_2410088K16Rik|Sh3bp4_chr1_89014498_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_2410088K16Rik|Sh3bp4_chr1_89014498_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Hmga1_chr17_27559663_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Hmga1_chr17_27559663_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Hmga1-rs1_chr11_120762983_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Hmga1-rs1_chr11_120762983_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_E230001N04Rik_chr17_28524085_F | TCGTCGGCAGCGTCTGGCGCTATTAATGTCAGCT | 57.3 | 0.00 |
| mm4_exon_E230001N04Rik_chr17_28524085_R | GTCTCGTGGGCTCGGCACTTCTGTAACCTCGCCCC | 60.3 | 0.00 |
| mm4_exon_Dbnl_chr11_5793630_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Dbnl_chr11_5793630_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_4930563D23Rik_chr16_92321425_F | TCGTCGGCAGCGTCGTTTGTGAAGCGAGCCATGG | 60.1 | 0.00 |
| mm4_exon_4930563D23Rik_chr16_92321425_R | GTCTCGTGGGCTCGGGCCCCTGACACGTAGCTATG | 60.2 | 0.00 |
| mm3_intron_Havcr1_chr11_46736728_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm3_intron_Havcr1_chr11_46736728_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm2_intron_Sufu_chr19_46477782_F | TCGTCGGCAGCGTCAGTTGCTGTGCTAGGAGCTG | 60.0 | 0.00 |
| mm2_intron_Sufu_chr19_46477782_R | GTCTCGTGGGCTCGGCTTGGTGATCAAGGGTGCGT | 60.6 | 0.00 |
These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313825 |
AGGGAGCCTGGGATTAGGAGCTTACTTGGGGGTTTTCCCCCTCCCCCCCTCTGGAGAGTCCGGGGATGGAGAGCCGAAAG GACATGGTTATGTTTCTGGATGGGGGTCAGCTTGGCACTCTGGTTGGTA |
| mm2_intergenic_Rxrb|Col11a2_chr17_34039129 |
GATTACGAGTGGGCGTGGAACGGTCGCCCGTAGGCCCGCCCCTTCTGTCCCACTGTGCCCTGAGTCCCTCCCCGGACTCT TCATAGGGGCTCTGGGCCCCCAAGGGCAGCTGCCGTGGTGTGAAAGGACTA |
| mm3_intron_Btbd16_chr7_130797858 |
TGCTTCTGGCTTTGACCCTTAGGTGTGTAATCTAGCCGCACCATCTCATGGTCTGACACAGCCCCACAGGGACCTTCCTC GGACTCTCCACAGAGGTGTAGCCACACTGTGCATGTGTCCTCCT |
| mm4_intron_Kctd3_chr1_188988363 |
ATGGGGCTGGGTTTTCCAAAGGTCCACAGGCACTGTCACGCTGGAGAATCCGAGGACGGTAAGAAAGGAGAGTGTGGTCT AAGGGACATCCACACTAAGATGAGAGTTACACTTCTGGCTCCTCTCAGGT |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911234 |
CGGGGTCAGTGGTTCACTCCCCCTCCCCGGACTCCCCTGCGGAGGGGGCTGACAGCGACGGTCGCGGGGCCTGGTGTCTC GGGGCTGTC |
| mm4_intergenic_Cers3|Adamts17_chr7_66835373 |
GACCATGGAATCAAGCCGGAAGAACAAAAGAGAGTCAAAGTGATGGGCTTCCCCACTTTTATTCTTGGCAAGCTTCCTTC TGGAGGCTCCAGGGAAGGAGAATTCGATAGCCATGTAACTTCACCCTCAGATAGCCCCA |
| mm4_intron_Col9a2_chr4_121040107 |
GCTATTCAGTCGACAGCGGAGCCTCCGCCCCCGGAGTCTCCTAAGGGACCCAGGCTCCAGCCAGACTTCCCTGTCGCCCC AATATG |
| mm3_intergenic_Gm14246|Gm22936_chr2_162742448 |
GTGACCACTTACAGGCAGCTCCCTGCAGACTGGAGAGATTCCCTCGCACATCCCCAGATCCCCTCTGCCACACAAGCCCT CCCTTGCCTTCTCCTGACTCTCCAGAGGCCACAGCAATTAGCTCCAGACAGTTCTCACGA |
| mm4_intron_Ablim2_chr5_35794655 |
GCATAGGCCTTAGGGTTGCACCATGCAGGCCCCCCAGAACCCTCTCCTGACTCTCCTGATGGTGCTTCCAAGCCTTGGCA TGGCTGGCCTGGGCCCATTCAGCTGCTCTTGGCCTCAGGTTAC |
| mm4_intron_Unc13c_chr9_73952449 |
GGCATGACTGAGTTGGGTCACTTGAAGATTCCTTCAATATTGTTACTCCTTTCCCTGACTTTCCAGAGTGCTGGTTGGTC CCCAAGGGCTCACACTGAGTCACTCTCTGAGAATGCTGCTTCCTACTCTGGGTG |
| mm4_intron_Adcy7_chr8_88313430 |
GACTGCTGACTCCCATCCAGGGCCCTCCTTCCCCGAACACTCCTGTGGGGACCCAGTTTCACCCTTGGTCAGCCCCCCTC TGCACCTTCCCTCTTCCTTCC |
| mm4_intron_Map3k10_chr7_27661707 | GTACTGCAGGGTGGTAAGCATAGAGAAAGGCTCTCTGTAGAGACAGGGGATGGCAGTAGCGGTCAGTGCTTCA |
| mm4_intergenic_Fbxo21|Tesc_chr5_118010562 |
ACACCGCTAGGCTACTCAGAATGAGCCCTCTCCACACCTGCAGCTTGCTGGCCCTCTGGAGAGGCCAGACAGGGGGACGG GTCTTCCTCAGTCAAGCC |
| mm4_intergenic_Zfp652|Phospho1_chr11_95780681 |
ACACCCAGCAGAAATCTTGGATCTTGAGGGAGAAACATGGGTAGAAACAGCTGGACTCCCTCCGTGGACACTCCAGAGAG GAATGTGCCTTTGGTGGCCAGCGTGGTGCAACTGTGTCCGACGTTCTATGCA |
| mm3_intergenic_Gm24371|BC024582_chr4_32540354 |
ACAGACTGTGTCAGGAACGTTCACTCAGAGATTCTCCAACCTTCCCCTGACACTCCAGAGAGATCATGGAAGTATGGGGA GAGAGGAGACAGATAAGGCATTAGCAGGAAGGAGCATACATGGGCAAGGACC |
| mm3_intergenic_Gm9843|Usp25_chr16_76470165 |
CTGTTTTCTGGCTGTGTTGGGTCCTCCCCGGACTTTCTAGATGGAGACCCATATCTAACTCTTATCCTTTTATATCTTGG TATGATTGACCTTTGGTTATGTCATGCTTGCACTTGACAC |
| mm3_exon_Gm26545_chr12_80885687 |
TGTAGATGAAGCCTGCCAGCTGAGCTCAACATCTGGAGAGTCGGGGGAAGGGGAGGGGGCATGTGAAACAAGTTCTTTGG TTCAGCACAAACACATCAGGCATATGCTGCCTCATTTCGGGG |
| mm3_exon_Efnb2_chr8_8620317 |
TCTCCTAAGATGCTGCTGCGCCATCCATAGCCTACCGTGTCCTCCCCGGGCTCTGCAGAGGCCTGAGTGGCTGGGTGCAT GGCTTGGAGGTCCGCGTGGGGCCGCGGCAGTCCAAGTGGGGATCTC |
| mm4_intergenic_St6gal1|Gm23430_chr16_23394800 |
ACAAGAACCAAAGAGAGCCCCCCTTCCCCAGAGTATCCAGAGGTCAGCATGATAAATGGGTAAGCTAGAAGGAACTTTAA AGGACCTGTGCTCTGATCAGACCACACTTTCTATATCACATGGACAACCGAACACA |
| mm4_intron_Add2_chr6_86110503 | CTAGCCCCTGAGAACAAGCCCCAGGTGACCCTCTGGAGAGCCAGCGGTGGGGACTCTGCCTCCATCTGTGCTTG |
| mm4_intron_Lrrc48_chr11_60382342 |
CCATTCGCACCTTCTGAGGACCAGGCTGGGGCCTGACTCACCCTCGAAACAAGTCCCTCTGGAGAGGCAGGTCATGGACC CCGCTAAACCTGACTCAGTGCCCTGCCTGTATCTCAGCCCACAAGAAGCTG |
| mm4_intron_Ass1_chr2_31509697 |
GCGTGTTCATGCATGTGTGTGCACAGCCGTCCCCCTCCCCCGACTCCCCAGTGGAAGGGAGGAAGGGCTATTTGGGGCCC TGGGCTCCACCGTAGTTGGTTTAATTACAGGTTTTCAACTGCAGGCC |
| mm4_intergenic_Pebp4|Egr3_chr14_70075565 |
CCGGGGATCCTCTCTTCCTTCTTGTCAACACTCCCACTCCCCCTGAGAGATGCAAGTTCCCCCAACCCCGACTCTCCAGC GGGGGCCGCGGGATTCACCGCGCCCACGCGGCCACTGAGGAGGGAATC |
| mm4_intron_Ppp1r9a_chr6_5110139 |
GCATCACTTAGTGGCTGTGCTCAGCTGCAGAGCAGAAAATGTTCATGGGCTTGGCTGCAAAGTGTCTCCCTCCCCAGACC CTCCACTGGGCTGTTTGGACCTATAAAACCGGGAGAATTGGGAATTTCA |
| mm4_intergenic_Gm11515|Tac4_chr11_95226386 |
GCCTGGCTGTCATCTCAGAACTTCTAGAACTCCTGGTCCCTCCCCCGACTCCCCAGTGCGTGTTTCCCAGCCCCCTATTT CCTCCCCAGATCACAGCAGATGCCT |
| mm4_intergenic_Stmn4|Gm23899_chr14_66456800 |
AGTGCAAGTCTTTCCCTCCATTTTTACAGACAAATAGCTTGCATGCCCGTCTCAGACTCTCCAGAGGGTCTGTATTAATT GATTTGGGACCAGATTCCATTACCAC |
| mm4_intergenic_Ccdc171|Gm27046_chr4_83589213 |
CAGGGAGCAGCCTTAGGAACTAAACGCCTGCCCCTCTGGAGGGGAGGGGGAAGGGAGAGTGTTCTTCGATTGTCCTCCTG ACCAGGAGGGTGGCCTTGTAAG |
| mm4_intron_Msi2_chr11_88548267 | TTTCAGCAAGGCCAGAGGAGTGTGCCCGCTGGAGAGCCCCGGGGAGGATCGCCGAGGAAGCAGACTCGTAGAAGCCTGC |
| mm4_intron_Actn1_chr12_80258861 |
TGAGCATTCTCCCTCAAGCCCAGCCCTAACCGCACTATCCAGAGGGACGCGCCATCCTGTACACCCCCCCCCCCATTCCC AGATCACGAAGTGGGGGGGGGGGGACTGAACGGGAGTTGGGTGTT |
| mm4_intergenic_Wfdc18|1100001G20Rik_chr11_83711395 |
TCCTTAGCATCCTTCCTGTTGAAGAGTTCTTATTTGTGTATCATATTGACTATTTTATTCACAAGAGCCATCCCTGCAGC CTCCAGAGGGTCCATAAACACAGACAGAGCCCT |
| mm4_intergenic_Tbx5|n-R5s176_chr5_120033702 |
TGACCTTAGCCTTCTGTCCTTGCACTCTGGAGAGTCCTGGATGGGTAGGGCCACTGCTTTCCTGCTGTGTCAGAATAGCA ATTTTGGTCTGAACAAGTCCTCACCCACTGAGTGATGCCTGTGT |
| mm4_intergenic_Mapk8|Ptpn20_chr14_33486794 |
TAGAGACCTGGGCCCAACTTCCCTCCCAGGGCAATCCAGAGGGCTGCATGTCTCTCTAGAAGCCATGGGCCAAGGGCAGA GCTCCTCAAT |
| mm4_intergenic_Gm8730|Cdh5_chr8_103737423 |
GACAGCATTGTAGAGATGGGGTATCTGAGACCTAAAACAAAGAAATCCTCTCTGGAAAGTGAGGGGAAGGTTGTTGCTTG GAGAGAAGCAGCCCTC |
| mm4_exon_E230001N04Rik_chr17_28524085 |
TGGCGCTATTAATGTCAGCTTTTCAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNAGTGCGGGCAGGGCATGGGGGGCGAGGTTACAGAAGTG |
| mm4_exon_4930563D23Rik_chr16_92321425 |
GTTTGTGAAGCGAGCCATGGGGCTCCCTGAGTGGCTCACATTTTCCCATCTGGGGAGTTCTGGGAGGGGGAGAAGGATGA CCTCACAAAGGGACATCTCACGCTGTACCATAGCTACGTGTCAGGGGC |
| mm2_intron_Sufu_chr19_46477782 |
AGTTGCTGTGCTAGGAGCTGCTTAATCAAAGGCCTGTTATGGGCTCATTAGTGTGGTCCACCACGGGCCACCCCTCAGGA GAGTCCTGGGAAGGCTGGCTTAGGTCCCGCCCTTCAGGCACGCACCCTTGATCACCAAG |