← return to the list of all guides
Contents:In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.
In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.
If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.
| Name | Primer Sequence | Tm | CFD Score |
|---|---|---|---|
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313823_F | Primer3: not found at this Tm | N.d. | 1.00 |
| ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313823_R | Primer3: not found at this Tm | N.d. | 1.00 |
| mm3_intergenic_Scaf4|Hunk_chr16_90292828_F | Primer3: not found at this Tm | N.d. | 0.80 |
| mm3_intergenic_Scaf4|Hunk_chr16_90292828_R | Primer3: not found at this Tm | N.d. | 0.80 |
| mm4_intron_Ncam1_chr9_49649172_F | TCGTCGGCAGCGTCATGTGAATAGAAGTACCCGTAGAG | 57.3 | 0.75 |
| mm4_intron_Ncam1_chr9_49649172_R | GTCTCGTGGGCTCGGTGCATACTGTTGGTGCCTGT | 59.8 | 0.75 |
| mm4_intron_Vps37c_chr19_10690350_F | Primer3: not found at this Tm | N.d. | 0.73 |
| mm4_intron_Vps37c_chr19_10690350_R | Primer3: not found at this Tm | N.d. | 0.73 |
| mm4_intergenic_Gm24193|Gm20563_chr13_61964931_F | Primer3: not found at this Tm | N.d. | 0.70 |
| mm4_intergenic_Gm24193|Gm20563_chr13_61964931_R | Primer3: not found at this Tm | N.d. | 0.70 |
| mm4_intergenic_Acaa2|Gm24559_chr18_74901976_F | Primer3: not found at this Tm | N.d. | 0.70 |
| mm4_intergenic_Acaa2|Gm24559_chr18_74901976_R | Primer3: not found at this Tm | N.d. | 0.70 |
| mm2_intergenic_Gm25577|Gm22537_chr12_118542878_F | Primer3: not found at this Tm | N.d. | 0.63 |
| mm2_intergenic_Gm25577|Gm22537_chr12_118542878_R | Primer3: not found at this Tm | N.d. | 0.63 |
| mm4_intergenic_Gm24237|Gm25342_chr10_106021381_F | Primer3: not found at this Tm | N.d. | 0.61 |
| mm4_intergenic_Gm24237|Gm25342_chr10_106021381_R | Primer3: not found at this Tm | N.d. | 0.61 |
| mm4_intergenic_Gm26449|AC158354.1_chr12_14925247_F | Primer3: not found at this Tm | N.d. | 0.59 |
| mm4_intergenic_Gm26449|AC158354.1_chr12_14925247_R | Primer3: not found at this Tm | N.d. | 0.59 |
| mm4_intergenic_Gyg|Cpa3_chr3_20191588_F | Primer3: not found at this Tm | N.d. | 0.58 |
| mm4_intergenic_Gyg|Cpa3_chr3_20191588_R | Primer3: not found at this Tm | N.d. | 0.58 |
| mm4_intron_Nfasc_chr1_132737214_F | Primer3: not found at this Tm | N.d. | 0.57 |
| mm4_intron_Nfasc_chr1_132737214_R | Primer3: not found at this Tm | N.d. | 0.57 |
| mm3_exon_Myl2_chr5_122100985_F | Primer3: not found at this Tm | N.d. | 0.54 |
| mm3_exon_Myl2_chr5_122100985_R | Primer3: not found at this Tm | N.d. | 0.54 |
| mm3_intergenic_Gm16079|Gm13049_chr4_150789611_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm3_intergenic_Gm16079|Gm13049_chr4_150789611_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Fgf10|Nnt_chr13_119208506_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Fgf10|Nnt_chr13_119208506_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Uty_chrY_1201506_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Uty_chrY_1201506_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Svopl_chr6_37996677_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Svopl_chr6_37996677_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Nfs1_chr2_156130139_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Nfs1_chr2_156130139_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Mgam_chr6_40634044_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Mgam_chr6_40634044_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Jmjd1c_chr10_67212431_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intron_Jmjd1c_chr10_67212431_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Zfp825|Erap1_chr13_74561762_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Zfp825|Erap1_chr13_74561762_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Terf2|C630050I24Rik_chr8_107108244_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Terf2|C630050I24Rik_chr8_107108244_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Rpl39-ps|Atp5g2_chr15_102649570_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Rpl39-ps|Atp5g2_chr15_102649570_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Npas4|Slc29a2_chr19_5015144_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Npas4|Slc29a2_chr19_5015144_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Hmga2|Gm24298_chr10_120494672_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Hmga2|Gm24298_chr10_120494672_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm26099|Gm24809_chrX_37067036_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm26099|Gm24809_chrX_37067036_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm26076|Gm25519_chr3_111465442_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm26076|Gm25519_chr3_111465442_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm23708|G6pd2_chr5_60748207_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm23708|G6pd2_chr5_60748207_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm13787|1110051M20Rik_chr2_91370020_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Gm13787|1110051M20Rik_chr2_91370020_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Cnpy2|Cs_chr10_128332651_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_intergenic_Cnpy2|Cs_chr10_128332651_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_exon_Tmem209_chr6_30507157_F | Primer3: not found at this Tm | N.d. | 0.53 |
| mm4_exon_Tmem209_chr6_30507157_R | Primer3: not found at this Tm | N.d. | 0.53 |
| mm3_intergenic_Gm25433|Senp6_chr9_80055961_F | Primer3: not found at this Tm | N.d. | 0.50 |
| mm3_intergenic_Gm25433|Senp6_chr9_80055961_R | Primer3: not found at this Tm | N.d. | 0.50 |
| mm4_intergenic_Fuk|St3gal2_chr8_110911727_F | Primer3: not found at this Tm | N.d. | 0.50 |
| mm4_intergenic_Fuk|St3gal2_chr8_110911727_R | Primer3: not found at this Tm | N.d. | 0.50 |
| mm3_intron_Rtn4rl1_chr11_75228018_F | Primer3: not found at this Tm | N.d. | 0.49 |
| mm3_intron_Rtn4rl1_chr11_75228018_R | Primer3: not found at this Tm | N.d. | 0.49 |
| mm4_intron_Pcsk5_chr19_17728297_F | Primer3: not found at this Tm | N.d. | 0.49 |
| mm4_intron_Pcsk5_chr19_17728297_R | Primer3: not found at this Tm | N.d. | 0.49 |
| mm4_intron_Slc28a1_chr7_81134216_F | Primer3: not found at this Tm | N.d. | 0.48 |
| mm4_intron_Slc28a1_chr7_81134216_R | Primer3: not found at this Tm | N.d. | 0.48 |
| mm4_intron_Itgav_chr2_83777779_F | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_intron_Itgav_chr2_83777779_R | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_intergenic_Diap3|Gm23278_chr14_87345278_F | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_intergenic_Diap3|Gm23278_chr14_87345278_R | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_intron_Camsap2_chr1_136306037_F | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_intron_Camsap2_chr1_136306037_R | Primer3: not found at this Tm | N.d. | 0.47 |
| mm4_exon_Tmem233_chr5_116040635_F | TCGTCGGCAGCGTCTCCCGACTAGTGGGTGTTCA | 60.1 | 0.46 |
| mm4_exon_Tmem233_chr5_116040635_R | GTCTCGTGGGCTCGGCTCATCTGCACACACTCCCA | 59.6 | 0.46 |
| mm4_intron_Cnst_chr1_179608773_F | Primer3: not found at this Tm | N.d. | 0.46 |
| mm4_intron_Cnst_chr1_179608773_R | Primer3: not found at this Tm | N.d. | 0.46 |
| mm3_intron_Iars_chr13_49725477_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm3_intron_Iars_chr13_49725477_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Tex2_chr11_106565958_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Tex2_chr11_106565958_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Kat8_chr7_127913914_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Kat8_chr7_127913914_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Heatr5b_chr17_78788476_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Heatr5b_chr17_78788476_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Ddx42_chr11_106234165_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Ddx42_chr11_106234165_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Zc3h12a|1700041M05Rik_chr4_125142022_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Zc3h12a|1700041M05Rik_chr4_125142022_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_exon_Rrm2b_chr15_37954534_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_exon_Rrm2b_chr15_37954534_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm3_intron_Myzap/Gcom1_chr9_71550962_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm3_intron_Myzap/Gcom1_chr9_71550962_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Ispd_chr12_36501358_F | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intron_Ispd_chr12_36501358_R | Primer3: not found at this Tm | N.d. | 0.45 |
| mm4_intergenic_Cntn5|Gm25365_chr9_11259088_F | Primer3: not found at this Tm | N.d. | 0.44 |
| mm4_intergenic_Cntn5|Gm25365_chr9_11259088_R | Primer3: not found at this Tm | N.d. | 0.44 |
| mm4_intron_Gm13097_chr4_149482648_F | Primer3: not found at this Tm | N.d. | 0.43 |
| mm4_intron_Gm13097_chr4_149482648_R | Primer3: not found at this Tm | N.d. | 0.43 |
| mm4_intron_Vmn2r117_chr17_23471725_F | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intron_Vmn2r117_chr17_23471725_R | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intergenic_Vmn2r-ps134|Vmn2r117_chr17_23446584_F | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intergenic_Vmn2r-ps134|Vmn2r117_chr17_23446584_R | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intergenic_Gm26881|Unc13b_chr4_43057352_F | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intergenic_Gm26881|Unc13b_chr4_43057352_R | Primer3: not found at this Tm | N.d. | 0.42 |
| mm4_intron_Ppm1b_chr17_85006245_F | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intron_Ppm1b_chr17_85006245_R | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intron_Yaf2_chr15_93294722_F | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intron_Yaf2_chr15_93294722_R | Primer3: not found at this Tm | N.d. | 0.41 |
| mm4_intron_March11_chr15_26326188_F | Primer3: not found at this Tm | N.d. | 0.40 |
| mm4_intron_March11_chr15_26326188_R | Primer3: not found at this Tm | N.d. | 0.40 |
| mm4_intron_Susd4_chr1_182834703_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intron_Susd4_chr1_182834703_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intron_Fbxo42_chr4_141177820_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intron_Fbxo42_chr4_141177820_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm16128|Slc25a16_chr10_62936869_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm16128|Slc25a16_chr10_62936869_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm11954|Sec14l4_chr11_4012233_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm11954|Sec14l4_chr11_4012233_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_exon_N4bp2l2_chr5_150648768_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_exon_N4bp2l2_chr5_150648768_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm25658|Atp2b1_chr10_98888770_F | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intergenic_Gm25658|Atp2b1_chr10_98888770_R | Primer3: not found at this Tm | N.d. | 0.38 |
| mm4_intron_a_chr2_154986776_F | Primer3: not found at this Tm | N.d. | 0.37 |
| mm4_intron_a_chr2_154986776_R | Primer3: not found at this Tm | N.d. | 0.37 |
| mm4_intron_Dlgap1_chr17_70475972_F | Primer3: not found at this Tm | N.d. | 0.37 |
| mm4_intron_Dlgap1_chr17_70475972_R | Primer3: not found at this Tm | N.d. | 0.37 |
| mm4_intron_Ecsit_chr9_22078809_F | Primer3: not found at this Tm | N.d. | 0.36 |
| mm4_intron_Ecsit_chr9_22078809_R | Primer3: not found at this Tm | N.d. | 0.36 |
| mm4_intergenic_Olfr221|Gm22354_chr14_52052680_F | Primer3: not found at this Tm | N.d. | 0.36 |
| mm4_intergenic_Olfr221|Gm22354_chr14_52052680_R | Primer3: not found at this Tm | N.d. | 0.36 |
| mm4_intergenic_Gm22810|Gm2824_chr15_24931921_F | Primer3: not found at this Tm | N.d. | 0.36 |
| mm4_intergenic_Gm22810|Gm2824_chr15_24931921_R | Primer3: not found at this Tm | N.d. | 0.36 |
| mm3_intergenic_Cpd|Tmigd1_chr11_76892996_F | Primer3: not found at this Tm | N.d. | 0.35 |
| mm3_intergenic_Cpd|Tmigd1_chr11_76892996_R | Primer3: not found at this Tm | N.d. | 0.35 |
| mm4_intergenic_Spink2|Rest_chr5_77224541_F | Primer3: not found at this Tm | N.d. | 0.35 |
| mm4_intergenic_Spink2|Rest_chr5_77224541_R | Primer3: not found at this Tm | N.d. | 0.35 |
| mm4_intron_Zfp64_chr2_168911036_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Zfp64_chr2_168911036_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Uba2_chr7_34155172_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Uba2_chr7_34155172_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Top2a_chr11_99006668_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Top2a_chr11_99006668_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Tln2_chr9_67309294_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Tln2_chr9_67309294_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Rnf20_chr4_49655043_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Rnf20_chr4_49655043_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Rfc4_chr16_23123084_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Rfc4_chr16_23123084_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Ncor1_chr11_62419261_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Ncor1_chr11_62419261_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Hoga1_chr19_42065486_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Hoga1_chr19_42065486_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Clmn_chr12_104790836_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Clmn_chr12_104790836_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Celf6_chr9_59593264_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_Celf6_chr9_59593264_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_4933416M07Rik_chr8_27145703_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intron_4933416M07Rik_chr8_27145703_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Wbp2|Trim47_chr11_116093289_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Wbp2|Trim47_chr11_116093289_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Olfr1137|Olfr1138_chr2_87721734_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Olfr1137|Olfr1138_chr2_87721734_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Mir344c|Mir344_chr7_61877220_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Mir344c|Mir344_chr7_61877220_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Lyg1|Gm23409_chr1_37968372_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Lyg1|Gm23409_chr1_37968372_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm8871|Gm8879_chr5_11112227_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm8871|Gm8879_chr5_11112227_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm6460|Gm8922_chr5_11666594_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm6460|Gm8922_chr5_11666594_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm25270|Gm12974_chr4_133808772_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm25270|Gm12974_chr4_133808772_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm23315|Rprm_chr2_53845617_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm23315|Rprm_chr2_53845617_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm21818|Gm21762_chr13_120202476_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm21818|Gm21762_chr13_120202476_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm11942|Rragd_chr4_32976767_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gm11942|Rragd_chr4_32976767_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gltscr1l|Gm26904/Gltscr1l_chr17_46822652_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Gltscr1l|Gm26904/Gltscr1l_chr17_46822652_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_D13Ertd608e|Tcstv1_chr13_119858721_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_D13Ertd608e|Tcstv1_chr13_119858721_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Cacna1b|Ehmt1_chr2_24764858_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_intergenic_Cacna1b|Ehmt1_chr2_24764858_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_exon_Siglec1_chr2_131072093_F | Primer3: not found at this Tm | N.d. | 0.34 |
| mm4_exon_Siglec1_chr2_131072093_R | Primer3: not found at this Tm | N.d. | 0.34 |
| mm3_intergenic_Cntn5|Gm25365_chr9_11936146_F | Primer3: not found at this Tm | N.d. | 0.33 |
| mm3_intergenic_Cntn5|Gm25365_chr9_11936146_R | Primer3: not found at this Tm | N.d. | 0.33 |
| mm4_intergenic_Gm13530|Lmx1b_chr2_33524641_F | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_intergenic_Gm13530|Lmx1b_chr2_33524641_R | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_exon_Foxj2_chr6_122833162_F | Primer3: not found at this Tm | N.d. | 0.31 |
| mm4_exon_Foxj2_chr6_122833162_R | Primer3: not found at this Tm | N.d. | 0.31 |
| mm3_intergenic_Gm12057|RP23-242C19.7/B3gnt2_chr11_22833560_F | Primer3: not found at this Tm | N.d. | 0.30 |
| mm3_intergenic_Gm12057|RP23-242C19.7/B3gnt2_chr11_22833560_R | Primer3: not found at this Tm | N.d. | 0.30 |
| mm3_exon_Nfatc1_chr18_80698418_F | Primer3: not found at this Tm | N.d. | 0.30 |
| mm3_exon_Nfatc1_chr18_80698418_R | Primer3: not found at this Tm | N.d. | 0.30 |
| mm4_intergenic_Maf/Gm15655|Dynlrb2_chr8_116171771_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Maf/Gm15655|Dynlrb2_chr8_116171771_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Naif1|Gm13412_chr2_32517279_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_Naif1|Gm13412_chr2_32517279_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_n-R5s157|Gm25423_chr7_116675081_F | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intergenic_n-R5s157|Gm25423_chr7_116675081_R | Primer3: not found at this Tm | N.d. | 0.29 |
| mm4_intron_Arhgef33_chr17_80358446_F | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intron_Arhgef33_chr17_80358446_R | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intergenic_Stk35|Tgm3_chr2_129842978_F | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intergenic_Stk35|Tgm3_chr2_129842978_R | Primer3: not found at this Tm | N.d. | 0.28 |
| mm4_intron_Synj1_chr16_90975478_F | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intron_Synj1_chr16_90975478_R | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intron_Fam168a_chr7_100832329_F | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intron_Fam168a_chr7_100832329_R | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Slc16a2|Gm9164_chrX_103857107_F | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Slc16a2|Gm9164_chrX_103857107_R | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Bptf|Gm11715_chr11_107139166_F | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Bptf|Gm11715_chr11_107139166_R | Primer3: not found at this Tm | N.d. | 0.27 |
| mm4_intergenic_Gm22788|Gm24432_chr18_34064850_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm22788|Gm24432_chr18_34064850_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm3_intergenic_Gm12123|Gm12122_chr11_35348214_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm3_intergenic_Gm12123|Gm12122_chr11_35348214_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_exon_Meis2_chr2_116049121_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_exon_Meis2_chr2_116049121_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Kars-ps1|Luzp4_chrX_148800731_F | TCGTCGGCAGCGTCGGGGCATCCTCTACATGTCC | 59.6 | 0.26 |
| mm4_intergenic_Kars-ps1|Luzp4_chrX_148800731_R | GTCTCGTGGGCTCGGCCCTTTGGCAGGCCTTGATA | 60.0 | 0.26 |
| mm4_intergenic_Gm8402|Gm5946_chrX_150095719_F | TCGTCGGCAGCGTCGGGGCATCCTCTACATGTCC | 59.6 | 0.26 |
| mm4_intergenic_Gm8402|Gm5946_chrX_150095719_R | GTCTCGTGGGCTCGGCCCTTTGGCAGGCCTTGATA | 60.0 | 0.26 |
| mm4_intergenic_Gm8383|Gm15097_chrX_149728056_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm8383|Gm15097_chrX_149728056_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm8366|Gm15100_chrX_149392705_F | TCGTCGGCAGCGTCGGGGCATCCTCTACATGTCC | 59.6 | 0.26 |
| mm4_intergenic_Gm8366|Gm15100_chrX_149392705_R | GTCTCGTGGGCTCGGCCCTTTGGCAGGCCTTGATA | 60.0 | 0.26 |
| mm4_intergenic_Gm8346|Gm15093_chrX_149223563_F | TCGTCGGCAGCGTCCGGAGTATGGGAATAAGGGGC | 59.9 | 0.26 |
| mm4_intergenic_Gm8346|Gm15093_chrX_149223563_R | GTCTCGTGGGCTCGGCCCTTTGGCAGGCCTTGATA | 60.0 | 0.26 |
| mm4_intergenic_Gm8320|Gm15114_chrX_148440145_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm8320|Gm15114_chrX_148440145_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm8303|Gm15107_chrX_148120782_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm8303|Gm15107_chrX_148120782_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15128|Gm15081_chrX_147843238_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15128|Gm15081_chrX_147843238_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15107|Gm15109_chrX_148234441_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15107|Gm15109_chrX_148234441_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15087|Gm15091_chrX_149897474_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15087|Gm15091_chrX_149897474_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15085|Gm15086_chrX_149506042_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_intergenic_Gm15085|Gm15086_chrX_149506042_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_exon_Gm8334_chrX_148613261_F | Primer3: not found at this Tm | N.d. | 0.26 |
| mm4_exon_Gm8334_chrX_148613261_R | Primer3: not found at this Tm | N.d. | 0.26 |
| mm3_intron_Sept5_chr16_18625808_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm3_intron_Sept5_chr16_18625808_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Gm23562|4930548G14Rik_chr15_46578416_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Gm23562|4930548G14Rik_chr15_46578416_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Hhipl2|Gm8214_chr1_183449271_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Hhipl2|Gm8214_chr1_183449271_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intron_Igf1r_chr7_68160318_F | TCGTCGGCAGCGTCTGCCCTTTAACCATGCCTGT | 59.8 | 0.25 |
| mm4_intron_Igf1r_chr7_68160318_R | GTCTCGTGGGCTCGGCTGCTCTCCATGAGTGCCAA | 60.0 | 0.25 |
| mm4_intergenic_Olfr1126|Pramel7_chr2_87460849_F | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intergenic_Olfr1126|Pramel7_chr2_87460849_R | Primer3: not found at this Tm | N.d. | 0.25 |
| mm4_intron_Fads2_chr19_10100902_F | TCGTCGGCAGCGTCGGCCATCTTCCACTTGGGG | 60.3 | 0.24 |
| mm4_intron_Fads2_chr19_10100902_R | GTCTCGTGGGCTCGGTGCATGTTCACAGCGCATAC | 59.5 | 0.24 |
| mm4_intergenic_Gm15096|Ott_chrX_149021207_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm15096|Ott_chrX_149021207_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm15081|Gm15080_chrX_147939880_F | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intergenic_Gm15081|Gm15080_chrX_147939880_R | Primer3: not found at this Tm | N.d. | 0.23 |
| mm4_intron_Rreb1_chr13_37793157_F | TCGTCGGCAGCGTCACCAGCAAAGAAACCAATGTGT | 59.2 | 0.22 |
| mm4_intron_Rreb1_chr13_37793157_R | GTCTCGTGGGCTCGGAAGGAACTGGGCCAACGTTT | 60.3 | 0.22 |
| mm4_intergenic_1700023L04Rik|Nrf1_chr6_30013741_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_1700023L04Rik|Nrf1_chr6_30013741_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Tle3|Rplp1_chr9_61783373_F | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Tle3|Rplp1_chr9_61783373_R | Primer3: not found at this Tm | N.d. | 0.21 |
| mm4_intergenic_Atrn|Gfra4/mmu-mir-6973b_chr2_131038137_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Atrn|Gfra4/mmu-mir-6973b_chr2_131038137_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Col13a1_chr10_61963369_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Col13a1_chr10_61963369_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Armc4_chr18_7151609_F | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intron_Armc4_chr18_7151609_R | Primer3: not found at this Tm | N.d. | 0.20 |
| mm4_intergenic_Gm15461|Mapre3_chr5_30833454_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intergenic_Gm15461|Mapre3_chr5_30833454_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm2_intron_Atf2_chr2_73819574_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm2_intron_Atf2_chr2_73819574_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_exon_Tanc1_chr2_59630192_F | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_exon_Tanc1_chr2_59630192_R | Primer3: not found at this Tm | N.d. | 0.19 |
| mm4_intron_Slc39a12_chr2_14442842_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intron_Slc39a12_chr2_14442842_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Gm13816|Gm13791_chr2_92808755_F | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Gm13816|Gm13791_chr2_92808755_R | Primer3: not found at this Tm | N.d. | 0.18 |
| mm4_intergenic_Olfr1219|Olfr1220_chr2_89093620_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intergenic_Olfr1219|Olfr1220_chr2_89093620_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Nrg2_chr18_36067967_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Nrg2_chr18_36067967_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Chst11_chr10_83035317_F | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Chst11_chr10_83035317_R | Primer3: not found at this Tm | N.d. | 0.17 |
| mm4_intron_Ntrk3_chr7_78268244_F | TCGTCGGCAGCGTCCCATCTAGGGACTGCCTTGT | 58.7 | 0.16 |
| mm4_intron_Ntrk3_chr7_78268244_R | GTCTCGTGGGCTCGGCTGTGGCACATCCTGGCTAA | 60.0 | 0.16 |
| mm4_intron_Agmo_chr12_37520160_F | Primer3: not found at this Tm | N.d. | 0.16 |
| mm4_intron_Agmo_chr12_37520160_R | Primer3: not found at this Tm | N.d. | 0.16 |
| mm3_intron_Dock8_chr19_25018434_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm3_intron_Dock8_chr19_25018434_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm3_intergenic_2410024N13Rik|Trim33_chr3_103242703_F | Primer3: not found at this Tm | N.d. | 0.15 |
| mm3_intergenic_2410024N13Rik|Trim33_chr3_103242703_R | Primer3: not found at this Tm | N.d. | 0.15 |
| mm2_intron_Stxbp5l_chr16_37329350_F | Primer3: not found at this Tm | N.d. | 0.14 |
| mm2_intron_Stxbp5l_chr16_37329350_R | Primer3: not found at this Tm | N.d. | 0.14 |
| mm2_exon_Tmem258_chr19_10206833_F | Primer3: not found at this Tm | N.d. | 0.14 |
| mm2_exon_Tmem258_chr19_10206833_R | Primer3: not found at this Tm | N.d. | 0.14 |
| mm4_intron_Zic4_chr9_91377992_F | TCGTCGGCAGCGTCCAATTGTTCTCACGGTGGCC | 59.7 | 0.14 |
| mm4_intron_Zic4_chr9_91377992_R | GTCTCGTGGGCTCGGCCCCTCCTCCTTTCTGTTTTCT | 59.6 | 0.14 |
| mm4_intergenic_Gm22610|Dpp10_chr1_123329585_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm22610|Dpp10_chr1_123329585_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm11368|Gm11367_chr13_30105903_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_Gm11368|Gm11367_chr13_30105903_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_A530020G20Rik|A730020M07Rik_chr3_121631988_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intergenic_A530020G20Rik|A730020M07Rik_chr3_121631988_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_March11_chr15_26347159_F | Primer3: not found at this Tm | N.d. | 0.13 |
| mm4_intron_March11_chr15_26347159_R | Primer3: not found at this Tm | N.d. | 0.13 |
| mm3_intergenic_Suv420h1|Chka/Gm16066_chr19_3844257_F | Primer3: not found at this Tm | N.d. | 0.12 |
| mm3_intergenic_Suv420h1|Chka/Gm16066_chr19_3844257_R | Primer3: not found at this Tm | N.d. | 0.12 |
| mm4_exon_Irf2bpl_chr12_86883412_F | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_exon_Irf2bpl_chr12_86883412_R | Primer3: not found at this Tm | N.d. | 0.11 |
| mm4_intergenic_Gm24979|Cdc5l_chr17_45238317_F | TCGTCGGCAGCGTCAGGGACAGACATACCTCACTCA | 59.9 | 0.11 |
| mm4_intergenic_Gm24979|Cdc5l_chr17_45238317_R | GTCTCGTGGGCTCGGGAGGAAAGATGGGGCTCAGG | 59.8 | 0.11 |
| mm4_intron_8030423F21Rik_chr5_52614294_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intron_8030423F21Rik_chr5_52614294_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Mir1264|Mir1298_chrX_147050400_F | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Mir1264|Mir1298_chrX_147050400_R | Primer3: not found at this Tm | N.d. | 0.10 |
| mm4_intergenic_Maf/Gm15655|Dynlrb2_chr8_116285495_F | TCGTCGGCAGCGTCGGGGCACAAAGTGGATAGCA | 60.3 | 0.09 |
| mm4_intergenic_Maf/Gm15655|Dynlrb2_chr8_116285495_R | GTCTCGTGGGCTCGGCCTCCCGAGTCCTAGTGAGG | 60.4 | 0.09 |
| mm4_exon_Prr14_chr7_127475053_F | TCGTCGGCAGCGTCGTCACCTGAGCGTCCTTTCT | 59.6 | 0.09 |
| mm4_exon_Prr14_chr7_127475053_R | GTCTCGTGGGCTCGGCGGGGTCGTAAAAGGCTTGA | 60.3 | 0.09 |
| mm4_intron_Rhoj_chr12_75358387_F | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intron_Rhoj_chr12_75358387_R | Primer3: not found at this Tm | N.d. | 0.09 |
| mm4_intergenic_4833418N17Rik|Sh3gl3_chr7_82076304_F | TCGTCGGCAGCGTCTGTCTGCACCTCTTACTGGA | 57.9 | 0.08 |
| mm4_intergenic_4833418N17Rik|Sh3gl3_chr7_82076304_R | GTCTCGTGGGCTCGGAGGGCACTCTCACACACATG | 59.9 | 0.08 |
| mm4_intergenic_Actl11|Camkv_chr9_107932860_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Actl11|Camkv_chr9_107932860_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Med26|Smim7_chr8_72559347_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Med26|Smim7_chr8_72559347_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Tex29|A230072I06Rik_chr8_12208178_F | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intergenic_Tex29|A230072I06Rik_chr8_12208178_R | Primer3: not found at this Tm | N.d. | 0.07 |
| mm4_intron_Vac14_chr8_110684510_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Vac14_chr8_110684510_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_exon_Nog_chr11_89302100_F | TCGTCGGCAGCGTCGAGGAGAGCACGCCGAGTC | 62.4 | 0.06 |
| mm4_exon_Nog_chr11_89302100_R | GTCTCGTGGGCTCGGCTCTCCTCGCGGCTCATG | 59.9 | 0.06 |
| mm4_intergenic_Slc24a3|Gm14093_chr2_145254521_F | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intergenic_Slc24a3|Gm14093_chr2_145254521_R | Primer3: not found at this Tm | N.d. | 0.06 |
| mm4_intron_Oma1_chr4_103349380_F | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intron_Oma1_chr4_103349380_R | Primer3: not found at this Tm | N.d. | 0.05 |
| mm4_intergenic_Tsen54|Llgl2_chr11_115823916_F | TCGTCGGCAGCGTCCACTACTGGGGCCACGATTG | 60.7 | 0.05 |
| mm4_intergenic_Tsen54|Llgl2_chr11_115823916_R | GTCTCGTGGGCTCGGTTACATACAGGGCGAGCCTG | 59.5 | 0.05 |
| mm4_intergenic_Gm25895|Samt1_chrX_153956209_F | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_intergenic_Gm25895|Samt1_chrX_153956209_R | Primer3: not found at this Tm | N.d. | 0.04 |
| mm4_exon_Shisa9_chr16_11984725_F | TCGTCGGCAGCGTCGTACTGCTGCTCACAGGGG | 60.0 | 0.04 |
| mm4_exon_Shisa9_chr16_11984725_R | GTCTCGTGGGCTCGGCTGGCCCATGACATCGAAGT | 60.1 | 0.04 |
| mm4_intron_Nphs1_chr7_30476609_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Nphs1_chr7_30476609_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cdk7_chr13_100710796_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Cdk7_chr13_100710796_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_exon_Ankrd24_chr10_81639298_F | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_exon_Ankrd24_chr10_81639298_R | Primer3: not found at this Tm | N.d. | 0.03 |
| mm4_intron_Itpa_chr2_130676327_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intron_Itpa_chr2_130676327_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ran|Gpr133_chr5_129088512_F | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Ran|Gpr133_chr5_129088512_R | Primer3: not found at this Tm | N.d. | 0.02 |
| mm4_intergenic_Dytn|Gm12748_chr1_63666870_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intergenic_Dytn|Gm12748_chr1_63666870_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Prdm14_chr1_13126574_F | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Prdm14_chr1_13126574_R | Primer3: not found at this Tm | N.d. | 0.01 |
| mm4_intron_Plekha7_chr7_116227013_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Plekha7_chr7_116227013_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Zmynd8_chr2_165874027_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Zmynd8_chr2_165874027_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Efcab6_chr15_83921804_F | TCGTCGGCAGCGTCTGACAAGCTTTGCCATGACC | 59.0 | 0.00 |
| mm4_intron_Efcab6_chr15_83921804_R | GTCTCGTGGGCTCGGCTACAGAGGGGTGGCAGAGA | 60.3 | 0.00 |
| mm4_intron_Dgat2_chr7_99176679_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intron_Dgat2_chr7_99176679_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911236_F | TCGTCGGCAGCGTCCGGGGTCAGTGGTTCACTC | 60.0 | 0.00 |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911236_R | GTCTCGTGGGCTCGGGACAGCCCCGAGACACCAG | 62.3 | 0.00 |
| mm4_intergenic_Gm25727|F830104G03Rik_chr3_56752295_F | TCGTCGGCAGCGTCGCTGCTGGAAACCTTCTTTGG | 60.0 | 0.00 |
| mm4_intergenic_Gm25727|F830104G03Rik_chr3_56752295_R | GTCTCGTGGGCTCGGACAGATGATTCCAGACACTCTG | 57.5 | 0.00 |
| mm4_intergenic_Gm22684|Anxa1_chr19_20094091_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gm22684|Anxa1_chr19_20094091_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gata6|Rbbp8_chr18_11232151_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Gata6|Rbbp8_chr18_11232151_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cnih3|Gm16547_chr1_181384034_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_intergenic_Cnih3|Gm16547_chr1_181384034_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Zfp692_chr11_58314404_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Zfp692_chr11_58314404_R | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Tnfaip2_chr12_111445098_F | TCGTCGGCAGCGTCCCGAGGCTGAATCAGAGACC | 59.8 | 0.00 |
| mm4_exon_Tnfaip2_chr12_111445098_R | GTCTCGTGGGCTCGGTGAACATGTTGGCCAGTCCT | 59.5 | 0.00 |
| mm4_exon_Sntb1_chr15_55906323_F | TCGTCGGCAGCGTCTGGACTCAGGTACCTGCTCC | 60.6 | 0.00 |
| mm4_exon_Sntb1_chr15_55906323_R | GTCTCGTGGGCTCGGCCACCAATGGTTCGTTCTGC | 59.7 | 0.00 |
| mm4_exon_Plekho2_chr9_65563925_F | TCGTCGGCAGCGTCAGGGAGGCAGTCTTCAGGAT | 59.9 | 0.00 |
| mm4_exon_Plekho2_chr9_65563925_R | GTCTCGTGGGCTCGGGAGACGGTGGAACTTGGGAG | 60.0 | 0.00 |
| mm4_exon_Bcl9_chr3_97208542_F | Primer3: not found at this Tm | N.d. | 0.00 |
| mm4_exon_Bcl9_chr3_97208542_R | Primer3: not found at this Tm | N.d. | 0.00 |
These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.
| mm4_intron_Ncam1_chr9_49649172 |
ATGTGAATAGAAGTACCCGTAGAGNNNNNNNNNNNNNNNNNNNNNNNNTCCACAATAATTCTTAAAGGCCACCTCTGGAG ATTCTGGGTAAGAATCCCAAATCATTTATCTAACAGGCACCAACAGTATGCA |
| mm4_exon_Tmem233_chr5_116040635 |
TCCCGACTAGTGGGTGTTCATTTGCCAGGGACCCGCCTCTGGAGAGTCCTGGAGGAAAAGATCTTACAGTTTTAAAATCA AGGATCCATTCCTCAGAAACTTCTTTGGGAGTGTGTGCAGATGAG |
| mm4_intergenic_Kars-ps1|Luzp4_chrX_148800731 |
GGGGCATCCTCTACATGTCCTCCTCTGTAAGAGAGTGAGGATCATCCTATATTTCTTCCTCTGACTCTCCAGAAGAGGAA GAATCAAGGTAATCCAGGTCAGGTATCAAGGCCTGCCAAAGGG |
| mm4_intergenic_Gm8402|Gm5946_chrX_150095719 |
GGGGCATCCTCTACATGTCCTCCTCTGTAAGAGAGTGAGGAACATCCTATATTTCTTCCTCTGACTCTCCAGAAGAGGAA GAATCAAGGTAATCCAGGTCAGGTATCAAGGCCTGCCAAAGGG |
| mm4_intergenic_Gm8366|Gm15100_chrX_149392705 |
GGGGCATCCTCTACATGTCCTCCTCTGTAAGAGAGTGAGGATCATCCTATATTTCTTCCTCTGACTCTCCAGAAGAGGAA GAATCAAGGTAATCCAGGTCAGGTATCAAGGCCTGCCAAAGGG |
| mm4_intergenic_Gm8346|Gm15093_chrX_149223563 |
CGGAGTATGGGAATAAGGGGCATCCTCTATATGTCCTCCTCTGTAAGAGAGTGAGGAACATCCTATATTTCTTCCTCTGA CTCTCCAGAAGAGGAAGAATCAAGGTAATCCAGGTCAGGTATCAAGGCCTGCCAAAGGG |
| mm4_intron_Igf1r_chr7_68160318 |
TGCCCTTTAACCATGCCTGTGTGCCCCTCCTCTGGAGTGGCGGGGGAGGTCCCCTCCTTTCCCCCCATGGTGCTGTAATT GGAAATTTGGTTACTGCACTAAATTTTAAGTTTTGGCACTCATGGAGAGCAG |
| mm4_intron_Fads2_chr19_10100902 |
GGCCATCTTCCACTTGGGGAGCGCCGAACACGAAGGCTGGAGCGCCCCCTTTGGAGAGTCCCAGGCTCCGGCTGGAACAG CGCGCAGTATGCGCTGTGAACATGCA |
| mm4_intron_Rreb1_chr13_37793157 |
ACCAGCAAAGAAACCAATGTGTTCTTAATGGTTTTTACCCAAACCATAAAGCCCTCCCTTGGAGAGACCGGGGAAGCACC CAAACGTTGGCCCAGTTCCTT |
| mm4_intron_Ntrk3_chr7_78268244 |
CCATCTAGGGACTGCCTTGTAAAAATTATTATTTGAACAGTTCTTCATCCTATGATCCCATGACTGTCCAGAAGAGGTGA CTAGGTTCATTGCAAACCATAGCATAAAGTCTGCCATTAGCCAGGATGTGCCACAG |
| mm4_intron_Zic4_chr9_91377992 |
CAATTGTTCTCACGGTGGCCCGGGGCCGCGGCCCCGAATCTATTCATTTCCTTAAGCGTTCAGCCGCCGCCTCTGTAGTG CCCGGGGTTTCACACGGACATTAAAGACTGAGAAAACAGAAAGGAGGAGGGG |
| mm4_intergenic_Gm24979|Cdc5l_chr17_45238317 |
AGGGACAGACATACCTCACTCATGTTCCCCGGAGGCTTCAGAGGTGGAGGGACATCCAGCCTGCCCTCACAAGCCCTGAG CCCCATCTTTCCTC |
| mm4_intergenic_Maf/Gm15655|Dynlrb2_chr8_116285495 |
GGGGCACAAAGTGGATAGCACCATTCCCTTTAGATCCCATGACTCTCCATAAGAGGAACAAAGTTGCAAGTCCTCACTAG GACTCGGGAGG |
| mm4_exon_Prr14_chr7_127475053 |
GTCACCTGAGCGTCCTTTCTCCAACTGCAGATCCTGCTCTGGAGACCCCGGTGATTCCAACATCGTCAAGCCTTTTACGA CCCCG |
| mm4_intergenic_4833418N17Rik|Sh3gl3_chr7_82076304 |
TGTCTGCACCTCTTACTGGAAGATCCCCGGTGTCTTCAGTGGAGGGGGAAGGGATATCAGCTTATGAGGCAAGTCTGACT TCACATGTGTGTGAGAGTGCCCT |
| mm4_exon_Nog_chr11_89302100 |
GAGGAGAGCACGCCGAGTCCGCGGCGCTGCCGTGCTCCCCGGTCCCTCCGGAGGTGGCTCACCCGAGGCTGAGCAGGCGC AGGGCAGGCAGCATGAGCCGCGAGGAGAG |
| mm4_intergenic_Tsen54|Llgl2_chr11_115823916 |
CACTACTGGGGCCACGATTGGTTGGAGAGCGGCCCCGCTCTGGAGACTCCCAGGATGCGCTCCTGCCCCGTCGGCTCGGC CTAGGAGGCGGGGCCGGGGCGGGGCGAGGGCTCGGCAGGCTCGCCCTGTATGTAA |
| mm4_exon_Shisa9_chr16_11984725 |
GTACTGCTGCTCACAGGGGGCAACCGCTCCGGAGCCGCCTCCGGAGAGGCCGGCGAGGGCGTCGGGGGCTCGGACGCACC GCCGACTCGAGCGCCCACGCCAGACTCCTGTCGGGGCTACTTCGATGTCATGGGCCAG |
| mm4_intron_Efcab6_chr15_83921804 |
TGACAAGCTTTGCCATGACCTTGTCTTTCCAGTCCCTCACTGCAGAGTCCGGGGTTTCACTGTCCCTTTAAGACATCTCT GCCACCCCTCTGTAG |
| mm4_intergenic_Zfp335|Gm11458/Zfp335_chr2_164911236 |
CGGGGTCAGTGGTTCACTCCCCCTCCCCGGACTCCCCTGCGGAGGGGGCTGACAGCGACGGTCGCGGGGCCTGGTGTCTC GGGGCTGTC |
| mm4_intergenic_Gm25727|F830104G03Rik_chr3_56752295 |
GCTGCTGGAAACCTTCTTTGGTTTTCTCAGTCTGTTCCCCAGACTTTCCCGAGGTGGTTCCAGAGTGTCTGGAATCATCT GT |
| mm4_exon_Tnfaip2_chr12_111445098 |
CCGAGGCTGAATCAGAGACCTCCATGTCTGAGGCGTCCTCTGAGGACCTGATGCCATCCCCGGAGGCTCCCGATGGGGAG GAGGAGTCTGCGAAGAAGAAGGAGAAGAAGTCCAAAGGACTGGCCAACATGTTCA |
| mm4_exon_Sntb1_chr15_55906323 |
TGGACTCAGGTACCTGCTCCGGGAGGTCGGTGAAGGCGGTGCGGACCCCGGCGGGAGAGTCCGGGGCTTGAGCGACACCG GGGACCGGGTGCCCGGTCCCGGAGCCCCTGCAGAACGAACCATTGGTGG |
| mm4_exon_Plekho2_chr9_65563925 |
AGGGAGGCAGTCTTCAGGATGGCCCCTACCTTGTTCCCTGGGGATCGCAGCAGGATAAAGCGGTGATGTTTCCGCTTGAG GAGAGTCCGGAGATCCTGGCACTTCTCATAGCTCCCAAGTTCCACCGTCTC |