← return to the list of all guides

Contents:

PCR primers for off-targets of TGGGATTAGGAGCTTACTTG GGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Maximum amplicon length:     Primer Tm:

NamePrimer Sequence Tm CFD Score
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313787_F TCGTCGGCAGCGTCCCTTGTCGCCTTAGCTCCTC 60.1 1.00
ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313787_R GTCTCGTGGGCTCGGGTCCTTTCGGCTCTCCATCC 60.1 1.00
mm4_intron_Grm7_chr6_111103688_F Primer3: not found at this Tm N.d. 0.47
mm4_intron_Grm7_chr6_111103688_R Primer3: not found at this Tm N.d. 0.47
mm3_intron_Ndc1_chr4_107411335_F TCGTCGGCAGCGTCGCCTGCCCTTAGGAGTTCTC 59.8 0.40
mm3_intron_Ndc1_chr4_107411335_R GTCTCGTGGGCTCGGTCCCCAGAGATGGTCATACC 57.8 0.40
mm4_intergenic_Palm2/Gm20459|Gm20459/Palm2_chr4_57626638_F Primer3: not found at this Tm N.d. 0.39
mm4_intergenic_Palm2/Gm20459|Gm20459/Palm2_chr4_57626638_R Primer3: not found at this Tm N.d. 0.39
mm4_intergenic_Eepd1|Gm26190_chr9_25811487_F Primer3: not found at this Tm N.d. 0.29
mm4_intergenic_Eepd1|Gm26190_chr9_25811487_R Primer3: not found at this Tm N.d. 0.29
mm4_intergenic_Gm27018|Gm8652_chr6_6341123_F Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Gm27018|Gm8652_chr6_6341123_R Primer3: not found at this Tm N.d. 0.24
mm4_intron_Cisd2_chr3_135419491_F Primer3: not found at this Tm N.d. 0.24
mm4_intron_Cisd2_chr3_135419491_R Primer3: not found at this Tm N.d. 0.24
mm4_intergenic_Psma4|Chrna5_chr9_54972868_F Primer3: not found at this Tm N.d. 0.23
mm4_intergenic_Psma4|Chrna5_chr9_54972868_R Primer3: not found at this Tm N.d. 0.23
mm4_intergenic_Gm26134|Gm23434_chr1_98564686_F Primer3: not found at this Tm N.d. 0.22
mm4_intergenic_Gm26134|Gm23434_chr1_98564686_R Primer3: not found at this Tm N.d. 0.22
mm4_intron_Itgae_chr11_73131402_F Primer3: not found at this Tm N.d. 0.20
mm4_intron_Itgae_chr11_73131402_R Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Htr1a|Dph3b-ps_chr13_106277609_F Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Htr1a|Dph3b-ps_chr13_106277609_R Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Gm1968|4632428C04Rik_chr16_30000735_F Primer3: not found at this Tm N.d. 0.20
mm4_intergenic_Gm1968|4632428C04Rik_chr16_30000735_R Primer3: not found at this Tm N.d. 0.20
mm4_intron_Gpc5_chr14_115302955_F Primer3: not found at this Tm N.d. 0.18
mm4_intron_Gpc5_chr14_115302955_R Primer3: not found at this Tm N.d. 0.18
mm3_intergenic_Sfxn5|Rab11fip5/Mir705_chr6_85334541_F TCGTCGGCAGCGTCCCTTGACTCTAGGGGAGCCT 60.0 0.16
mm3_intergenic_Sfxn5|Rab11fip5/Mir705_chr6_85334541_R GTCTCGTGGGCTCGGAATGGCTCATGCTGTGTCCA 59.9 0.16
mm4_intron_Mob3b_chr4_35057565_F Primer3: not found at this Tm N.d. 0.15
mm4_intron_Mob3b_chr4_35057565_R Primer3: not found at this Tm N.d. 0.15
mm4_intron_Spata13_chr14_60675235_F Primer3: not found at this Tm N.d. 0.15
mm4_intron_Spata13_chr14_60675235_R Primer3: not found at this Tm N.d. 0.15
mm4_intron_Rasgef1c_chr11_49967638_F Primer3: not found at this Tm N.d. 0.14
mm4_intron_Rasgef1c_chr11_49967638_R Primer3: not found at this Tm N.d. 0.14
mm4_intergenic_Igsf3|Atp1a1_chr3_101560702_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Igsf3|Atp1a1_chr3_101560702_R Primer3: not found at this Tm N.d. 0.13
mm4_intron_Mfsd2a_chr4_122954757_F Primer3: not found at this Tm N.d. 0.13
mm4_intron_Mfsd2a_chr4_122954757_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm25509|n-R5-8s1_chr18_73104639_F Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_Gm25509|n-R5-8s1_chr18_73104639_R Primer3: not found at this Tm N.d. 0.13
mm4_intergenic_D630008O14Rik|Bcl2_chr1_106625465_F TCGTCGGCAGCGTCAGCACAGTAGAGGAGGAGGT 59.2 0.13
mm4_intergenic_D630008O14Rik|Bcl2_chr1_106625465_R GTCTCGTGGGCTCGGTCTAAATGTTTTAAAGTTCGCTGGT 57.7 0.13
mm4_intergenic_Sept5|Cldn5_chr16_18664790_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Sept5|Cldn5_chr16_18664790_R Primer3: not found at this Tm N.d. 0.09
mm4_intron_Zfp644_chr5_106645876_F Primer3: not found at this Tm N.d. 0.09
mm4_intron_Zfp644_chr5_106645876_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm22438|Gm22159_chr1_108142445_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Gm22438|Gm22159_chr1_108142445_R Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Tll1|Mir710_chr8_64364162_F Primer3: not found at this Tm N.d. 0.09
mm4_intergenic_Tll1|Mir710_chr8_64364162_R Primer3: not found at this Tm N.d. 0.09
mm3_intergenic_Higd1a|Ackr2_chr9_121868442_F TCGTCGGCAGCGTCCACTGACGTACTTAACAGTGAGGA 60.0 0.08
mm3_intergenic_Higd1a|Ackr2_chr9_121868442_R GTCTCGTGGGCTCGGGAACCTCGGTCATGCTGGAA 60.0 0.08
mm4_intron_Acot7_chr4_152267595_F TCGTCGGCAGCGTCACAGGGTCCCTTTGCTTCAC 60.1 0.08
mm4_intron_Acot7_chr4_152267595_R GTCTCGTGGGCTCGGGCTGGAAGAAAGGAGCTGGT 59.9 0.08
mm4_intron_Ubash3b_chr9_41158425_F TCGTCGGCAGCGTCAAGGGTTCTGAGTCGGGAGT 60.1 0.08
mm4_intron_Ubash3b_chr9_41158425_R GTCTCGTGGGCTCGGGTGGAGGTTGCTGGTCCTAC 60.0 0.08
mm4_intergenic_Cadm2|Gm24681_chr16_68105912_F Primer3: not found at this Tm N.d. 0.07
mm4_intergenic_Cadm2|Gm24681_chr16_68105912_R Primer3: not found at this Tm N.d. 0.07
mm4_intron_Abcc12_chr8_86559528_F Primer3: not found at this Tm N.d. 0.07
mm4_intron_Abcc12_chr8_86559528_R Primer3: not found at this Tm N.d. 0.07
mm4_intron_Pld1_chr3_27965807_F Primer3: not found at this Tm N.d. 0.06
mm4_intron_Pld1_chr3_27965807_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Mical2|Micalcl_chr7_112356585_F Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Mical2|Micalcl_chr7_112356585_R Primer3: not found at this Tm N.d. 0.06
mm3_intergenic_Gm22159|Gm25293_chr1_109765794_F Primer3: not found at this Tm N.d. 0.06
mm3_intergenic_Gm22159|Gm25293_chr1_109765794_R Primer3: not found at this Tm N.d. 0.06
mm3_intron_Nbea_chr3_55969690_F Primer3: not found at this Tm N.d. 0.06
mm3_intron_Nbea_chr3_55969690_R Primer3: not found at this Tm N.d. 0.06
mm4_intergenic_Cdh5|Bean1_chr8_104160809_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Cdh5|Bean1_chr8_104160809_R Primer3: not found at this Tm N.d. 0.05
mm4_intron_Top1mt_chr15_75670579_F TCGTCGGCAGCGTCTTGTGGCCCTAACTCACACC 59.8 0.05
mm4_intron_Top1mt_chr15_75670579_R GTCTCGTGGGCTCGGTGGACTCTTTGGGTTTGGGG 59.8 0.05
mm4_intergenic_Slit3|Mir218-2_chr11_35614601_F TCGTCGGCAGCGTCTTTCCCCTAAAAGCAGCCCC 60.2 0.05
mm4_intergenic_Slit3|Mir218-2_chr11_35614601_R GTCTCGTGGGCTCGGGCTGGTAAAGAGGCAGAGCA 60.0 0.05
mm4_intergenic_Gm25974|Epha4_chr1_77328114_F TCGTCGGCAGCGTCAGGCCTAGATAGCAGCACCT 60.1 0.05
mm4_intergenic_Gm25974|Epha4_chr1_77328114_R GTCTCGTGGGCTCGGCGATCCAATTGACCCCGCTA 59.8 0.05
mm4_intron_Yipf1_chr4_107315487_F Primer3: not found at this Tm N.d. 0.05
mm4_intron_Yipf1_chr4_107315487_R Primer3: not found at this Tm N.d. 0.05
mm3_intergenic_Stim2|Gm24235_chr5_54288474_F Primer3: not found at this Tm N.d. 0.05
mm3_intergenic_Stim2|Gm24235_chr5_54288474_R Primer3: not found at this Tm N.d. 0.05
mm3_intron_Pkhd1_chr1_20389518_F Primer3: not found at this Tm N.d. 0.05
mm3_intron_Pkhd1_chr1_20389518_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Setbp1|Gm25824_chr18_79133067_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Setbp1|Gm25824_chr18_79133067_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Vegfc|Spcs3_chr8_54373316_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Vegfc|Spcs3_chr8_54373316_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Gm11510|Msi2_chr11_88460762_F Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Gm11510|Msi2_chr11_88460762_R Primer3: not found at this Tm N.d. 0.05
mm4_intergenic_Npvf|G930045G22Rik_chr6_50835095_F TCGTCGGCAGCGTCTAGCATCACCCAAGTGGCTC 59.7 0.04
mm4_intergenic_Npvf|G930045G22Rik_chr6_50835095_R GTCTCGTGGGCTCGGGAGCTTCTCAGAGACGAGCC 59.8 0.04
mm4_intergenic_Gm22967|Dlgap1_chr17_69617584_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Gm22967|Dlgap1_chr17_69617584_R Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Gm24246|Pik3c3_chr18_30151808_F Primer3: not found at this Tm N.d. 0.04
mm4_intergenic_Gm24246|Pik3c3_chr18_30151808_R Primer3: not found at this Tm N.d. 0.04
mm3_intergenic_Gm9915|2610017I09Rik_chr1_42410644_F Primer3: not found at this Tm N.d. 0.03
mm3_intergenic_Gm9915|2610017I09Rik_chr1_42410644_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Olfr225|Mprip_chr11_59641514_F Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Olfr225|Mprip_chr11_59641514_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm23345|Usp47_chr7_111950231_F Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm23345|Usp47_chr7_111950231_R Primer3: not found at this Tm N.d. 0.03
mm4_intron_Ppp3ca_chr3_136898346_F TCGTCGGCAGCGTCGTGTCTCTGCATCCCTCTGG 59.8 0.03
mm4_intron_Ppp3ca_chr3_136898346_R GTCTCGTGGGCTCGGCTGTCTACAACGCTGGAGCT 59.7 0.03
mm4_intergenic_Gm24880|Gm10172_chr7_71017670_F Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm24880|Gm10172_chr7_71017670_R Primer3: not found at this Tm N.d. 0.03
mm4_intergenic_Gm10612/Cbfa2t3|Acsf3_chr8_122732333_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm10612/Cbfa2t3|Acsf3_chr8_122732333_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm15228|Tmsb4x_chrX_167188513_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Gm15228|Tmsb4x_chrX_167188513_R Primer3: not found at this Tm N.d. 0.02
mm4_exon_Klhdc8a_chr1_132306013_F TCGTCGGCAGCGTCGCTCTTTGTGCTACTTCCCAG 58.9 0.02
mm4_exon_Klhdc8a_chr1_132306013_R GTCTCGTGGGCTCGGCCTCAGGGCTAACTCAGAGC 59.5 0.02
mm4_intron_Dock4_chr12_40631374_F Primer3: not found at this Tm N.d. 0.02
mm4_intron_Dock4_chr12_40631374_R Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Ly6f|9030619P08Rik_chr15_75377051_F TCGTCGGCAGCGTCCCTCAGCACAAGAGGCTTCA 59.9 0.02
mm4_intergenic_Ly6f|9030619P08Rik_chr15_75377051_R GTCTCGTGGGCTCGGCAGTACCCGAGATGTGCTGG 60.1 0.02
mm4_intergenic_Mc2r|mmu-mir-6356_chr18_68445585_F Primer3: not found at this Tm N.d. 0.02
mm4_intergenic_Mc2r|mmu-mir-6356_chr18_68445585_R Primer3: not found at this Tm N.d. 0.02
mm3_intergenic_Gm25166|Pi15_chr1_17543781_F Primer3: not found at this Tm N.d. 0.01
mm3_intergenic_Gm25166|Pi15_chr1_17543781_R Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_AC166813.1|2610316D01Rik_chr3_45257208_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_AC166813.1|2610316D01Rik_chr3_45257208_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Ggta1_chr2_35408635_F Primer3: not found at this Tm N.d. 0.01
mm4_intron_Ggta1_chr2_35408635_R Primer3: not found at this Tm N.d. 0.01
mm3_intergenic_Gm5815|2610034M16Rik_chr17_58620135_F TCGTCGGCAGCGTCAGCAAAGTCAGAGACAGACTC 57.3 0.01
mm3_intergenic_Gm5815|2610034M16Rik_chr17_58620135_R GTCTCGTGGGCTCGGAAGTGCAGGATGGCCTTCTC 60.0 0.01
mm3_intergenic_Cbln2|Gm5096_chr18_87070841_F TCGTCGGCAGCGTCTGAGGTAGAGAAGAGGGGAGA 58.4 0.01
mm3_intergenic_Cbln2|Gm5096_chr18_87070841_R GTCTCGTGGGCTCGGTCTGTTCTAGCACATGAACAGGT 59.6 0.01
mm4_exon_Gm21975/Evi2b_chr11_79514548_F Primer3: not found at this Tm N.d. 0.01
mm4_exon_Gm21975/Evi2b_chr11_79514548_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Pcmtd1_chr1_7152270_F Primer3: not found at this Tm N.d. 0.01
mm4_intron_Pcmtd1_chr1_7152270_R Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Tnrc6a|Slc5a11_chr7_123197571_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Tnrc6a|Slc5a11_chr7_123197571_R Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Slc30a10|Lyplal1_chr1_185742049_F Primer3: not found at this Tm N.d. 0.01
mm4_intergenic_Slc30a10|Lyplal1_chr1_185742049_R Primer3: not found at this Tm N.d. 0.01
mm4_intron_Chrdl1_chrX_143303089_F TCGTCGGCAGCGTCTGAATGTTGGGTGTCCTGCT 59.5 0.00
mm4_intron_Chrdl1_chrX_143303089_R GTCTCGTGGGCTCGGGAGGCAGCCTCTAACACTGT 59.3 0.00
mm4_intergenic_Gm25704|Gm14103_chr2_133045945_F TCGTCGGCAGCGTCAACTGAGCAAGAGGCCCAAA 59.8 0.00
mm4_intergenic_Gm25704|Gm14103_chr2_133045945_R GTCTCGTGGGCTCGGCCAGTCCCAACATCTTCGCT 60.0 0.00
mm4_intergenic_Slitrk5|Gm22764_chr14_111814473_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Slitrk5|Gm22764_chr14_111814473_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15219|Cdkn3_chr14_46757958_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm15219|Cdkn3_chr14_46757958_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hs1bp3|Rhob_chr12_8448692_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Hs1bp3|Rhob_chr12_8448692_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4913|Gm16420_chrX_120047381_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm4913|Gm16420_chrX_120047381_R Primer3: not found at this Tm N.d. 0.00
mm3_intron_Auts2_chr5_131707747_F TCGTCGGCAGCGTCGTTTTGGCAAGCGGTCTGG 60.0 0.00
mm3_intron_Auts2_chr5_131707747_R GTCTCGTGGGCTCGGTCTGGAGCCTGTTCAAACTCA 59.2 0.00
mm4_intergenic_Nek7|Lhx9_chr1_138771302_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Nek7|Lhx9_chr1_138771302_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccser1|Gm22212_chr6_62872945_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ccser1|Gm22212_chr6_62872945_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ttc37_chr13_76167459_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ttc37_chr13_76167459_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Rfesd_chr13_76006858_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Rfesd_chr13_76006858_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Fbxl4_chr4_22385450_F TCGTCGGCAGCGTCCTTCATGCAAGTGCTCCTGC 59.8 0.00
mm4_intron_Fbxl4_chr4_22385450_R GTCTCGTGGGCTCGGCCACAGGTATCTCCTCTTCAGC 59.8 0.00
mm4_intron_Dync1i1_chr6_5893608_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Dync1i1_chr6_5893608_R Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ccbl2_chr3_142721653_F Primer3: not found at this Tm N.d. 0.00
mm4_intron_Ccbl2_chr3_142721653_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r90|Gm23837_chr17_17748307_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Vmn2r90|Gm23837_chr17_17748307_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ttc27|Ltbp1_chr17_74957252_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Ttc27|Ltbp1_chr17_74957252_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Slc9a1|Gm13257_chr4_133444281_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Slc9a1|Gm13257_chr4_133444281_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Sik2|Layn_chr9_51022988_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Sik2|Layn_chr9_51022988_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr446|Olfr444_chr6_42952345_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr446|Olfr444_chr6_42952345_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr294|Olfr293_chr7_86656933_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Olfr294|Olfr293_chr7_86656933_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Msr1|Fgf20_chr8_40135802_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Msr1|Fgf20_chr8_40135802_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Lpl|Slc18a1_chr8_69014010_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Lpl|Slc18a1_chr8_69014010_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9578|Gm22891_chr14_81961915_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm9578|Gm22891_chr14_81961915_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25656|Cntn6_chr6_103882696_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm25656|Cntn6_chr6_103882696_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm23203|Gm23447_chr17_59823999_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Gm23203|Gm23447_chr17_59823999_R Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_Fryl|Ociad1_chr5_73292504_F TCGTCGGCAGCGTCAGGGAAGTCCAAGGAAAGTCA 58.5 0.00
mm4_intergenic_Fryl|Ociad1_chr5_73292504_R GTCTCGTGGGCTCGGAGCTCTGCCTCTAGGTTCGA 60.0 0.00
mm4_intergenic_AC161214.1|Gm11033_chr8_74367535_F Primer3: not found at this Tm N.d. 0.00
mm4_intergenic_AC161214.1|Gm11033_chr8_74367535_R Primer3: not found at this Tm N.d. 0.00
mm4_exon_Zfp641_chr15_98289062_F TCGTCGGCAGCGTCAGGGCACGTGTGTGGTTTTA 60.1 0.00
mm4_exon_Zfp641_chr15_98289062_R GTCTCGTGGGCTCGGGTCCAAGCTGGGAGTCCATG 60.3 0.00
mm4_exon_2310061I04Rik/Gm16279_chr17_35895807_F Primer3: not found at this Tm N.d. 0.00
mm4_exon_2310061I04Rik/Gm16279_chr17_35895807_R Primer3: not found at this Tm N.d. 0.00

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

ontarget_mm0_exon_5730457N03Rik/Evx1_chr6_52313787 CCTTGTCGCCTTAGCTCCTCTTCTCAGCCAAGATCCCAGGGAGCCTGGGATTAGGAGCTTACTTGGGGGTTTTCCCCCTC
CCCCCCTCTGGAGAGTCCGGGGATGGAGAGCCGAAAGGAC
mm3_intron_Ndc1_chr4_107411335 GCCTGCCCTTAGGAGTTCTCCAAGAGCTAATACGAGAAGGCTTGTGCATTGAAAGTTTTTTCTAGGTCCTTGATGGGCCT
CTGGGATTAAGAGCTTACATATGGACTTGGTATGACCATCTCTGGGGA
mm3_intergenic_Sfxn5|Rab11fip5/Mir705_chr6_85334541 CCTTGACTCTAGGGGAGCCTCTGTCTCATGGTGGGATTCAGAGCTAACTTGGGGTTGCCCTCTTGTCCTTCTGGACACAG
CATGAGCCATT
mm4_intergenic_D630008O14Rik|Bcl2_chr1_106625465 AGCACAGTAGAGGAGGAGGTTGAACTTTCATCAGGTGGGACAGTTATCCCATGTAGAGAAAAAAATCTCTAACTCACTTT
ATTCCCCCAAGTAAGATTCAAATCCTAATAAAACCAGCGAACTTTAAAACATTTAGA
mm3_intergenic_Higd1a|Ackr2_chr9_121868442 CACTGACGTACTTAACAGTGAGGAAAAACATGGGGTTTGGAGCTCACTTGGGGAAGCATTGGTGCTGTTCCAGCATGACC
GAGGTTC
mm4_intron_Acot7_chr4_152267595 ACAGGGTCCCTTTGCTTCACATGGCATGAGGAACCTACTTGTGGCTGCAGGTGGGCAGTCTAGCAGCCAAGAGCTGCCCA
TGGCCCTGTGGCCACCAGCTCCTTTCTTCCAGC
mm4_intron_Ubash3b_chr9_41158425 AAGGGTTCTGAGTCGGGAGTCGGGATCCCTGCTGCATAGGAGCCACAAGTGAGCTCCCACCCCCACCCCAGTAGGACCAG
CAACCTCCAC
mm4_intron_Top1mt_chr15_75670579 TTGTGGCCCTAACTCACACCTTGAGCCTTACTCTGTCAGAAAATGACCAAATGAAATCCCCAAGTGAGCCCCTAAATCCA
CATCCTTCCCCTAAAGCAAGGCCTCCCATGTCCCCAAACCCAAAGAGTCCA
mm4_intergenic_Slit3|Mir218-2_chr11_35614601 TTTCCCCTAAAAGCAGCCCCCTTGAAAAAACAGCTGATGAGATTAGGAGCCAATTTGAGGGCTGCTCCTGCAACATGTCC
AGCCCCTCCCTGGGTAGGGCGTCTGGCTTCCCAGCCACTTTGCTCTGCCTCTTTACCAGC
mm4_intergenic_Gm25974|Epha4_chr1_77328114 AGGCCTAGATAGCAGCACCTTCCTCAAAGAACCTGTTGGCATTTGAAGCTCACTTGAGGATGATAGCGGGGTCAATTGGA
TCG
mm4_intergenic_Npvf|G930045G22Rik_chr6_50835095 TAGCATCACCCAAGTGGCTCATTCCGCAATCATGCTCCTAATCTCAAGGCTCATCTGCTCTCGTCTAAAGCTACGGAAAT
GCTTTCCCACCTCATTCTTGTATTCAGACATTCCTCAGACGGCTCGTCTCTGAGAAGCTC
mm4_intron_Ppp3ca_chr3_136898346 GTGTCTCTGCATCCCTCTGGGACAAAGCATAAGTGATGGGTGGGCTTAGGAACTCACTGGCGGGATGGAGAAGCTCCAGC
GTTGTAGACAG
mm4_exon_Klhdc8a_chr1_132306013 GCTCTTTGTGCTACTTCCCAGTCATTCATATTGGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAACTAGCTCTGAGTTAGCCCTGAGG
mm4_intergenic_Ly6f|9030619P08Rik_chr15_75377051 CCTCAGCACAAGAGGCTTCACCCACCACAAGTCAATTCCCAATCCCATGACCCCAGCACATCTCGGGTACTG
mm3_intergenic_Gm5815|2610034M16Rik_chr17_58620135 AGCAAAGTCAGAGACAGACTCGCAGTCATTTAAAGGGAGTAGCAGCTTACTTGAGACGTTTAGAGGTTTGTCTCTGAAAA
TGCCTGCCTAATGGCTAATAGAGCCTCCCATACGTCTGAGAAGGCCATCCTGCACTT
mm3_intergenic_Cbln2|Gm5096_chr18_87070841 TGAGGTAGAGAAGAGGGGAGAAGTAAATTGTACTAAGTCCACAACTAAGCTCCTAATACAAAGGTAGGAAATAAATATAA
AAATTAATGAGGTTGCTGTCATTAATACAACATTAACCTGTTCATGTGCTAGAACAGA
mm4_intron_Chrdl1_chrX_143303089 TGAATGTTGGGTGTCCTGCTTATTAAAAAAAAAAAAGTGGATTTTTTTTCCACAAGTGACCTCCAACTCCCAGAGGCAAT
GTTTACAGTGTTAGAGGCTGCCTC
mm4_intergenic_Gm25704|Gm14103_chr2_133045945 AACTGAGCAAGAGGCCCAAATGGTATCAGGGGCTGACTTGCGGGAACAGTGACTTCGCACCTTCTTAGCGAAGATGTTGG
GACTGG
mm3_intron_Auts2_chr5_131707747 GTTTTGGCAAGCGGTCTGGTGTTCCCCTACCAAGCTCCTAATCCCAGCAGATCAGTTAAAATAAATGAAAGAGAGAATCA
AAAGGCACTTAAAAAATTCAACTGTTCTCCAAATGAGTTTGAACAGGCTCCAGA
mm4_intron_Fbxl4_chr4_22385450 CTTCATGCAAGTGCTCCTGCACACGTCCTCCCCACACGGAAGGAACATGGGATTTTGAGCTTTCATGGGGCCAATAACGG
AAATAAAAATGCTGAAGAGGAGATACCTGTGG
mm4_intergenic_Fryl|Ociad1_chr5_73292504 AGGGAAGTCCAAGGAAAGTCATGGGATAAGGAGGGGACTTGAGGATGGAGGGGTTCCAAAATGTCCCTACTGGCTTGTCA
CTGAACAGTCTCTGGGGTATGTCACAAGAGCATCGAACCTAGAGGCAGAGCT
mm4_exon_Zfp641_chr15_98289062 AGGGCACGTGTGTGGTTTTAAGAGAGAGTCTGTGTCTGTTCTGTGTAGATGGCGAGAGAAGGTGTCCTCCTGAAGGAAGC
GTGGGCTTAGGAGCATTCCTGTGGAGTTCCTGGGCATGGACTCCCAGCTTGGAC

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.

After sequencing, run CRISPRessoPooled. The tool will map the reads to the amplicons and analyse the mutations:
CRISPRessoPooled -r1 Reads1.fastq.gz -r2 Reads2.fastq.gz -f crisporAmplicons_mN1FkRligAThyqKv3eg3.txt --name MY_EXPERIMENT

Version 5.01 - Documentation  - Contact us - Downloads/local installation - Citation - License
CRISPR/Cas9 Guide Designer for chordate vertebrate ecdysozoans lophotrochozoans protostomes spongi corals plants butterflies metazoans genomes fruitflies insects nematodes mammals.