← return to the list of all guides
The following table lists possible deletions.
Each sequence below represents the context around the guide's target, with deleted nucleotides shown as "-".
Sequences are ranked by micro-homology score. This score is correlated to the likelihood of finding a particular deletion, as predicted by the method of Bae et al. 2014.
| mh- Score | Sequence | Effect |
|---|---|---|
| AGAAAGAAGAGGGCAATGGGGCTTCCTCCCAGAGGCGGTGCGGCACAGAGGAGCGCTCGCATCACAAGGTGACCCTAGCT | (Wild-type sequence) | |
| 467 | GGGCAATGGGGCTTCCTCCCAGAGGCGG-----CACAGAGGAGCGCTCGCATCACAAGGT | 5 bp deleted → frameshift |
| 449 | GGGCAATGGGGCTTCCTCCCAGAGG----------------AGCGCTCGCATCACAAGGT | 16 bp deleted → frameshift |
| 402 | GGGCAATGGGGCTTCCTCCCAGAGGC--------ACAGAGGAGCGCTCGCATCACAAGGT | 8 bp deleted → frameshift |
| 244 | GGGCAATGGGGCTTCCTCCCAGAGGCG------------------CTCGCATCACAAGGT | 18 bp deleted → no frameshift |
| 208 | GGGCAATGGGGCTTCCTCCCAGAGGCGG-------------AGCGCTCGCATCACAAGGT | 13 bp deleted → frameshift |
| 199 | GGGCAATGGGGC----------------------ACAGAGGAGCGCTCGCATCACAAGGT | 22 bp deleted → frameshift |
| 193 | GGGCAATGGGGCTTCCTCCCAGAG-------------------CGCTCGCATCACAAGGT | 19 bp deleted → frameshift |
| 156 | GGGCA------------------------------CAGAGGAGCGCTCGCATCACAAGGT | 30 bp deleted → no frameshift |
| 149 | GGGCAATGGGGCTTCCTCCCAGAG--------------AGGAGCGCTCGCATCACAAGGT | 14 bp deleted → frameshift |
| 149 | GGGCAATGGGGCTTCCTCCCA--------------CAGAGGAGCGCTCGCATCACAAGGT | 14 bp deleted → frameshift |
| 147 | GGGCAATGGGGCTTCCTCCCAGAGGC--------------------TCGCATCACAAGGT | 20 bp deleted → frameshift |
| 133 | GGGCAATGGGGCTTCCTCCCAGAGGCG----------------------CATCACAAGGT | 22 bp deleted → frameshift |
| 126 | GGGCAATGGG-----------------------CACAGAGGAGCGCTCGCATCACAAGGT | 23 bp deleted → frameshift |
| 122 | GGGCAATGGGGCTTCCTCCCAG------------------GAGCGCTCGCATCACAAGGT | 18 bp deleted → no frameshift |
| 120 | GGGCAATGGGGCTTCCTCCCAGAGGC------------------------ATCACAAGGT | 24 bp deleted → no frameshift |
| 120 | GGGCAATGG------------------------CACAGAGGAGCGCTCGCATCACAAGGT | 24 bp deleted → no frameshift |
| 111 | GGGCAATGGGGCTTCCTC------------------------------GCATCACAAGGT | 30 bp deleted → no frameshift |
| 106 | GGGCAATGGGGCTTCCTCCCAGAGGCGGT------------------------------- | 31 bp deleted → frameshift |
| 105 | GGGCAATGGGGCTTCCTCCCAG---------------------CGCTCGCATCACAAGGT | 21 bp deleted → no frameshift |
| 91 | GGGCAATGGGGCTTCCTCCCAGAGG----------------------------------T | 34 bp deleted → frameshift |
| 91 | GGGCAATGGGGCT----------------------------------CGCATCACAAGGT | 34 bp deleted → frameshift |
| 89 | GGGCAATGGGG------------------------------AGCGCTCGCATCACAAGGT | 30 bp deleted → no frameshift |
| 84 | GGGCAATGGG-------------------------------AGCGCTCGCATCACAAGGT | 31 bp deleted → frameshift |
| 84 | GG-------------------------------CACAGAGGAGCGCTCGCATCACAAGGT | 31 bp deleted → frameshift |
| 80 | GGGCAATGGGGC--------------------------------GCTCGCATCACAAGGT | 32 bp deleted → frameshift |
| 80 | GGGCAATGG--------------------------------AGCGCTCGCATCACAAGGT | 32 bp deleted → frameshift |
| 66 | GGGCAATGGGGCTTCCTCCCA------------------------------TCACAAGGT | 30 bp deleted → no frameshift |
| 60 | GGGCA--------------------------------GAGGAGCGCTCGCATCACAAGGT | 32 bp deleted → frameshift |
| 60 | GGGCAATGGGGC--------------------------------------ATCACAAGGT | 38 bp deleted → frameshift |
| 60 | GGG--------------------------------------AGCGCTCGCATCACAAGGT | 38 bp deleted → frameshift |
| 57 | GGGCAATGGGGCTTCCTCCCA---------------------------------CAAGGT | 33 bp deleted → no frameshift |
| 57 | GGGCAATGGGGCTTC---------------------------------GCATCACAAGGT | 33 bp deleted → no frameshift |
| 56 | GG---------------------------------------AGCGCTCGCATCACAAGGT | 39 bp deleted → no frameshift |
| 54 | GGGC----------------------------------------GCTCGCATCACAAGGT | 40 bp deleted → frameshift |
| 52 | GGGCAATGGGGCTTCCTCCCA-----------------------------------AGGT | 35 bp deleted → frameshift |
| 52 | GGGCAATGGGGCTTCCTC-----------------------------------ACAAGGT | 35 bp deleted → frameshift |
| 50 | GGGCA----------------------------------------------TCACAAGGT | 46 bp deleted → frameshift |
| 49 | GGGCAATGGGGCTTCCTCCCAG------------------------------------GT | 36 bp deleted → no frameshift |
| 48 | GGGC------------------------------------------TCGCATCACAAGGT | 42 bp deleted → no frameshift |
| 45 | GGGCAATGGGGCTTC--------------------------------------ACAAGGT | 38 bp deleted → frameshift |
| 36 | GGGCAATGGGG------------------------------------------------T | 48 bp deleted → no frameshift |
| 34 | GGGCAATGGG-------------------------------------------------T | 49 bp deleted → frameshift |
| 32 | GGGCAATGG--------------------------------------------------T | 50 bp deleted → frameshift |
| 31 | GGGCAA---------------------------------------------------GGT | 51 bp deleted → no frameshift |
| 25 | GGGCA-------------------------------------------------CAAGGT | 49 bp deleted → frameshift |
| 24 | GGG--------------------------------------------------------T | 56 bp deleted → frameshift |
| 23 | GG---------------------------------------------------------T | 57 bp deleted → no frameshift |
| 21 | GGGCAAT---------------------------------------------CACAAGGT | 45 bp deleted → no frameshift |