← return to the list of all guides

• PCR Primers
• Amplicon sequences
• Crispresso support

PCR primers for off-targets of CGCATCCGGCGCGGACGCCA TGG

In the table below, Illumina Nextera Handle sequences have been added and highlighted in bold. Primers for the on-target have been added for convenience. The table below is sorted by the CFD off-target score. Sites with very low CFD scores < 0.02 are unlikely to be cleaved, see our study Haeussler et al. 2016, Figure 2.

In the protocol by Matthew Canver, Harvard, two PCRs are run: one PCR to amplify the potential off-target, then a second PCR to extend the handles with Illumina barcodes. Please click here to download the protocol. Alternatively, you can have a look at Fu et al, 2014.

If a primer was not found, the reason is usually that the region around the off-target is too repetitive. To avoid unspecific primers, all repeats are masked for the primer design (not for off-target search). If you think that we should change the parameters here or should use different primer3 settings, please let us know.

Off-target amplicon sequences with primers

These only list off-targets that have primers in the table above. Primers underlined, off-targets in bold.

Input file for Crispresso

Crispresso, written by Luca Pinello, is a software package to quantify the Cas9-induced mutations on off- or on-targets.

Click here to download an amplicon input file for Crispresso. For each off-target, it includes the off-target name, its PCR amplicon and the guide sequence. Keep a copy of this file.